Incidental Mutation 'R6148:Pcdhb14'
ID489041
Institutional Source Beutler Lab
Gene Symbol Pcdhb14
Ensembl Gene ENSMUSG00000044043
Gene Nameprotocadherin beta 14
SynonymsPcdhbN, 2210006M07Rik, Pcdhb17
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R6148 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location37447656-37456350 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37449230 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 463 (N463S)
Ref Sequence ENSEMBL: ENSMUSP00000054111 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052387] [ENSMUST00000056915] [ENSMUST00000115661] [ENSMUST00000194544]
PDB Structure
Solution structure of mouse protocadherin beta 14 (26-137) [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000052387
AA Change: N463S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000054111
Gene: ENSMUSG00000044043
AA Change: N463S

DomainStartEndE-ValueType
Pfam:Cadherin_2 30 112 1.4e-35 PFAM
CA 155 240 1.53e-20 SMART
CA 264 345 3.52e-29 SMART
CA 368 449 2.24e-22 SMART
CA 473 559 2.38e-26 SMART
CA 589 670 4.12e-12 SMART
Pfam:Cadherin_C_2 685 768 4.9e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056915
SMART Domains Protein: ENSMUSP00000061087
Gene: ENSMUSG00000047307

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 58 130 5.5e-1 SMART
CA 154 239 8.55e-19 SMART
CA 263 343 3.36e-26 SMART
CA 366 447 2.24e-22 SMART
CA 471 557 1.08e-24 SMART
CA 587 668 1.25e-11 SMART
Pfam:Cadherin_C_2 685 768 2.4e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 95% (61/64)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T A 12: 71,187,426 C1067S possibly damaging Het
Agbl3 T A 6: 34,857,753 S952R possibly damaging Het
Ano9 A G 7: 141,106,785 Y429H probably damaging Het
Bbs7 C A 3: 36,613,266 R7L probably damaging Het
Birc3 T A 9: 7,849,683 D535V possibly damaging Het
Catsper4 A G 4: 134,217,929 V206A probably damaging Het
Ccdc73 T G 2: 104,992,137 S810R possibly damaging Het
Cd177 A T 7: 24,744,273 L800* probably null Het
Cd34 T C 1: 194,948,008 probably null Het
Cep78 G A 19: 15,981,786 R95* probably null Het
Cfap69 T C 5: 5,663,996 D12G probably benign Het
Cpne7 A G 8: 123,127,432 D286G probably benign Het
Cwc22 ATCTCTCTCTCTCTCTCT ATCTCTCTCTCTCTCT 2: 77,929,459 probably null Het
Cxcl5 A T 5: 90,759,706 I46L probably benign Het
Cyp19a1 C T 9: 54,180,256 G59D probably damaging Het
Dclre1c A G 2: 3,437,705 D35G probably damaging Het
Dvl1 A G 4: 155,854,952 Y279C probably damaging Het
Fes A G 7: 80,380,296 L578P probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Fmn2 T C 1: 174,666,663 S1248P probably damaging Het
Fmo1 T G 1: 162,851,519 S53R probably damaging Het
Gabrg1 A T 5: 70,774,461 M313K probably damaging Het
Galnt10 T C 11: 57,784,648 C578R probably damaging Het
Gm13178 T C 4: 144,721,317 T30A possibly damaging Het
Gm15293 A G 8: 21,202,412 N83S probably benign Het
Gpr39 T C 1: 125,872,586 V358A probably damaging Het
Gsap A G 5: 21,226,325 R216G probably damaging Het
Gsap A T 5: 21,270,577 T570S probably benign Het
Gucy2d A T 7: 98,443,823 I136L probably benign Het
Hap1 A T 11: 100,349,392 V294E probably damaging Het
Ipo8 A G 6: 148,799,780 V514A probably damaging Het
Irf5 T C 6: 29,535,959 L324P probably damaging Het
Itsn1 C T 16: 91,816,852 R251C probably damaging Het
Klf11 T C 12: 24,651,568 probably null Het
Kpna6 G A 4: 129,649,306 Q439* probably null Het
Mark4 A T 7: 19,429,516 S563T probably benign Het
Mrpl21 A T 19: 3,283,084 I5L probably benign Het
Muc4 T C 16: 32,753,802 I1226T probably benign Het
Myrf G A 19: 10,212,475 T815I probably damaging Het
Olfr1211 C T 2: 88,930,253 V21I probably benign Het
Olfr515-ps1 A T 7: 108,844,971 probably null Het
Olfr665 A G 7: 104,881,082 Y125C possibly damaging Het
Olfr743 A G 14: 50,534,321 N303S probably benign Het
Olfr961 G T 9: 39,647,259 D178Y probably damaging Het
Os9 T C 10: 127,099,943 D280G probably benign Het
Pex19 G A 1: 172,134,039 E271K probably damaging Het
Ppdpf G A 2: 181,187,848 S32N probably benign Het
Prdm2 A G 4: 143,132,907 I1271T probably benign Het
Rbbp4 T C 4: 129,321,958 T262A probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Spaca9 G A 2: 28,693,781 R64W probably damaging Het
Sult1e1 A T 5: 87,579,911 S171T probably damaging Het
Tns1 T C 1: 73,953,453 T689A probably damaging Het
Unc13c G C 9: 73,693,366 N1365K probably benign Het
Vmn2r52 T C 7: 10,171,163 I250V probably benign Het
Vmn2r55 C A 7: 12,668,142 L406F probably benign Het
Wdcp T C 12: 4,850,621 V159A possibly damaging Het
Zbtb3 C T 19: 8,804,196 A391V probably benign Het
Znhit1 A T 5: 136,982,633 S109T probably benign Het
Other mutations in Pcdhb14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02260:Pcdhb14 APN 18 37450033 missense probably benign 0.28
IGL02314:Pcdhb14 APN 18 37450195 missense probably benign 0.03
IGL02411:Pcdhb14 APN 18 37449770 missense possibly damaging 0.78
IGL02553:Pcdhb14 APN 18 37448018 nonsense probably null
IGL02797:Pcdhb14 APN 18 37449851 missense probably damaging 1.00
IGL03184:Pcdhb14 APN 18 37449032 missense probably benign 0.00
IGL03352:Pcdhb14 APN 18 37449004 missense possibly damaging 0.67
R0166:Pcdhb14 UTSW 18 37448489 unclassified probably null
R0467:Pcdhb14 UTSW 18 37449224 missense probably damaging 0.98
R0675:Pcdhb14 UTSW 18 37448339 missense possibly damaging 0.91
R0730:Pcdhb14 UTSW 18 37448868 missense probably damaging 1.00
R1119:Pcdhb14 UTSW 18 37448587 missense probably damaging 0.99
R1121:Pcdhb14 UTSW 18 37449592 missense probably damaging 1.00
R1338:Pcdhb14 UTSW 18 37449890 missense probably benign 0.00
R1726:Pcdhb14 UTSW 18 37449594 nonsense probably null
R1743:Pcdhb14 UTSW 18 37448178 missense probably benign 0.01
R1779:Pcdhb14 UTSW 18 37449482 missense probably damaging 1.00
R1795:Pcdhb14 UTSW 18 37449535 missense probably benign
R2131:Pcdhb14 UTSW 18 37447870 missense probably benign 0.00
R2133:Pcdhb14 UTSW 18 37447870 missense probably benign 0.00
R3792:Pcdhb14 UTSW 18 37449662 missense probably damaging 1.00
R3916:Pcdhb14 UTSW 18 37448545 missense possibly damaging 0.48
R4197:Pcdhb14 UTSW 18 37448305 missense probably benign 0.01
R4282:Pcdhb14 UTSW 18 37450142 missense probably damaging 1.00
R4657:Pcdhb14 UTSW 18 37448847 missense possibly damaging 0.92
R4801:Pcdhb14 UTSW 18 37448278 missense probably benign 0.28
R4802:Pcdhb14 UTSW 18 37448278 missense probably benign 0.28
R5022:Pcdhb14 UTSW 18 37450170 missense probably benign 0.03
R5034:Pcdhb14 UTSW 18 37448806 missense probably damaging 0.98
R5664:Pcdhb14 UTSW 18 37448996 missense possibly damaging 0.54
R5840:Pcdhb14 UTSW 18 37448750 missense probably benign 0.23
R5966:Pcdhb14 UTSW 18 37448242 missense probably benign
R6090:Pcdhb14 UTSW 18 37448606 missense probably benign 0.45
R6187:Pcdhb14 UTSW 18 37448444 missense probably damaging 1.00
R6972:Pcdhb14 UTSW 18 37449692 missense probably damaging 1.00
X0065:Pcdhb14 UTSW 18 37449421 missense possibly damaging 0.95
X0065:Pcdhb14 UTSW 18 37449984 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTTCTACACGTTGGTAACTGAAAGAG -3'
(R):5'- GCCCACATGGAACTCAAAGG -3'

Sequencing Primer
(F):5'- CACGTTGGTAACTGAAAGAGCACTG -3'
(R):5'- TGGAACTCAAAGGCCTGC -3'
Posted On2017-10-10