Incidental Mutation 'R6149:Olfr218'
ID489051
Institutional Source Beutler Lab
Gene Symbol Olfr218
Ensembl Gene ENSMUSG00000046643
Gene Nameolfactory receptor 218
SynonymsOlfr1405-ps1, GA_x6K02T2R7CC-643715-642847, GA_x6K02SYWG4P-534-1100, MOR267-3, MOR267-3
MMRRC Submission 044296-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R6149 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location173197808-173206336 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 173204015 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 220 (V220F)
Ref Sequence ENSEMBL: ENSMUSP00000150815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057548] [ENSMUST00000215844] [ENSMUST00000216603]
Predicted Effect probably benign
Transcript: ENSMUST00000057548
AA Change: V220F

PolyPhen 2 Score 0.153 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000053317
Gene: ENSMUSG00000046643
AA Change: V220F

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 3.4e-58 PFAM
Pfam:7tm_1 42 291 2.8e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215844
AA Change: V220F

PolyPhen 2 Score 0.153 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000216603
AA Change: V220F

PolyPhen 2 Score 0.153 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930558K02Rik T A 1: 161,949,642 R115S probably benign Het
Adgre1 A G 17: 57,445,018 K589E probably benign Het
Adgrv1 A T 13: 81,182,774 L74Q probably damaging Het
Avil A G 10: 127,006,582 I77V probably benign Het
Best2 T C 8: 85,013,267 E57G probably benign Het
C87977 A G 4: 144,207,413 S375P probably damaging Het
Cacna1a T C 8: 84,569,952 C1200R probably damaging Het
Catsperb T A 12: 101,549,839 I578K probably damaging Het
Chsy1 A G 7: 66,125,385 Y154C probably damaging Het
Chuk A G 19: 44,101,831 V74A probably damaging Het
Ckb T C 12: 111,671,814 S49G probably damaging Het
Crtac1 A G 19: 42,283,609 Y632H unknown Het
Ern1 C A 11: 106,405,815 E770* probably null Het
Fam114a2 A C 11: 57,487,589 V450G probably benign Het
Fgf15 C T 7: 144,899,769 Q125* probably null Het
Frem2 A T 3: 53,551,341 S2036T probably damaging Het
Fxr2 G A 11: 69,649,204 V296I probably benign Het
Gm15264 C A 3: 94,733,429 noncoding transcript Het
Gm340 T A 19: 41,585,202 W799R probably damaging Het
Ifi213 A T 1: 173,594,015 S103T probably benign Het
Igkv5-37 T A 6: 69,963,488 Q57H probably damaging Het
Il1rap A G 16: 26,712,219 Y435C probably damaging Het
Kl T A 5: 150,988,853 M689K possibly damaging Het
Lnp1 C T 16: 56,917,372 E118K probably benign Het
Lrif1 A C 3: 106,732,327 K243Q possibly damaging Het
Lrp1b G T 2: 40,875,153 probably null Het
Lvrn G A 18: 46,884,432 V610I probably benign Het
Med1 T C 11: 98,183,853 K67R possibly damaging Het
Midn T C 10: 80,154,457 S278P probably damaging Het
Nrap A G 19: 56,389,453 V35A possibly damaging Het
Nynrin A T 14: 55,854,323 Q32L possibly damaging Het
Olfr1265 C T 2: 90,037,516 A199V probably benign Het
Olfr1328 A G 4: 118,934,431 L139P probably damaging Het
Olfr1444 A T 19: 12,862,359 I195F probably benign Het
Olfr2 T C 7: 107,001,600 I87V probably benign Het
Oog1 C T 12: 87,606,273 T113I possibly damaging Het
Otogl C T 10: 107,881,453 V386I probably benign Het
Patj A G 4: 98,424,325 N300S possibly damaging Het
Pcdhb16 T A 18: 37,479,155 D389E possibly damaging Het
Pdcd6ip T C 9: 113,659,871 I699V probably benign Het
Pfas A G 11: 68,991,945 V790A probably benign Het
Plppr4 A T 3: 117,322,394 C605S probably benign Het
Ppl G A 16: 5,107,596 Q60* probably null Het
Ppp1r1c A G 2: 79,756,466 K52R possibly damaging Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Rpe65 G A 3: 159,614,143 E217K probably benign Het
Rufy4 T C 1: 74,147,733 I560T probably benign Het
Ryr2 T C 13: 11,669,017 S3054G probably benign Het
Serpinb6a A T 13: 33,918,360 L273H probably damaging Het
Sf3b1 A T 1: 55,007,507 W293R probably damaging Het
Sik1 A T 17: 31,848,797 S435T possibly damaging Het
Slc2a12 G T 10: 22,664,502 M85I probably benign Het
Stk36 T C 1: 74,634,229 S1094P probably benign Het
Tctn1 A T 5: 122,246,586 Y393N probably benign Het
Tex9 C T 9: 72,462,000 probably null Het
Thbs2 A G 17: 14,679,680 probably null Het
Tmprss7 A T 16: 45,673,905 C412* probably null Het
Tpp1 T C 7: 105,747,727 T399A probably benign Het
Trim25 T A 11: 89,015,536 V387D probably benign Het
Usp45 A C 4: 21,810,797 D331A probably damaging Het
Vill T G 9: 119,058,414 V82G possibly damaging Het
Vmn1r189 T C 13: 22,101,884 D261G probably benign Het
Vmn2r111 G A 17: 22,548,815 T567I probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r60 A G 7: 42,136,976 Y401C probably damaging Het
Zc3h11a G A 1: 133,638,875 R69* probably null Het
Other mutations in Olfr218
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03404:Olfr218 APN 1 173204199 missense probably benign 0.08
R0265:Olfr218 UTSW 1 173203917 missense probably benign 0.10
R1388:Olfr218 UTSW 1 173203878 missense probably benign 0.01
R1463:Olfr218 UTSW 1 173203367 missense probably benign
R1547:Olfr218 UTSW 1 173203672 nonsense probably null
R1698:Olfr218 UTSW 1 173203371 missense probably damaging 1.00
R1892:Olfr218 UTSW 1 173204228 missense probably damaging 1.00
R4773:Olfr218 UTSW 1 173204229 missense probably damaging 1.00
R4939:Olfr218 UTSW 1 173203463 missense possibly damaging 0.95
R5473:Olfr218 UTSW 1 173204165 missense probably benign 0.02
R6582:Olfr218 UTSW 1 173204280 missense probably benign 0.00
R7151:Olfr218 UTSW 1 173204066 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCTGGGTCACTGGGAATTG -3'
(R):5'- TGTAAGTCACTGAGATGAGCCTG -3'

Sequencing Primer
(F):5'- CATGGCTATTGTCCAGGTTACATCAG -3'
(R):5'- TCACTGAGATGAGCCTGTCCTG -3'
Posted On2017-10-10