Incidental Mutation 'R6149:Tpp1'
ID489070
Institutional Source Beutler Lab
Gene Symbol Tpp1
Ensembl Gene ENSMUSG00000030894
Gene Nametripeptidyl peptidase I
SynonymsCln2
MMRRC Submission 044296-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6149 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location105744811-105752235 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105747727 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 399 (T399A)
Ref Sequence ENSEMBL: ENSMUSP00000033184 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033182] [ENSMUST00000033184] [ENSMUST00000141116] [ENSMUST00000149695] [ENSMUST00000163389] [ENSMUST00000210066]
Predicted Effect probably benign
Transcript: ENSMUST00000033182
SMART Domains Protein: ENSMUSP00000033182
Gene: ENSMUSG00000030890

DomainStartEndE-ValueType
ANK 33 62 4.71e-6 SMART
ANK 66 95 1.04e-7 SMART
ANK 99 128 1.02e-1 SMART
Pfam:Pkinase 193 445 1.5e-25 PFAM
Pfam:Pkinase_Tyr 193 446 7.2e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000033184
AA Change: T399A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000033184
Gene: ENSMUSG00000030894
AA Change: T399A

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pro-kuma_activ 32 176 4.53e-50 SMART
low complexity region 177 189 N/A INTRINSIC
Pfam:Peptidase_S8 251 492 1.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000054556
Predicted Effect probably benign
Transcript: ENSMUST00000130565
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131683
Predicted Effect probably benign
Transcript: ENSMUST00000141116
SMART Domains Protein: ENSMUSP00000118105
Gene: ENSMUSG00000043866

DomainStartEndE-ValueType
low complexity region 17 39 N/A INTRINSIC
low complexity region 45 91 N/A INTRINSIC
Pfam:TFIID_30kDa 128 177 6.1e-30 PFAM
low complexity region 181 192 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146999
Predicted Effect probably benign
Transcript: ENSMUST00000149695
Predicted Effect probably benign
Transcript: ENSMUST00000163389
SMART Domains Protein: ENSMUSP00000130341
Gene: ENSMUSG00000030890

DomainStartEndE-ValueType
ANK 33 62 4.71e-6 SMART
ANK 66 95 1.04e-7 SMART
ANK 99 128 1.02e-1 SMART
Pfam:Pkinase_Tyr 193 446 4e-39 PFAM
Pfam:Pkinase 195 445 3e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210018
Predicted Effect probably benign
Transcript: ENSMUST00000210066
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210395
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210730
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210840
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211204
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211226
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211560
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211659
Meta Mutation Damage Score 0.13 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: This gene encodes a lysosomal serine protease that cleaves N-terminal tripeptides from protein substrates. The encoded preproprotein undergoes autocatalytic processing to generate a mature enzyme. Mice lacking the encoded protein exhibit a progressive neurodegeneration and a greatly shortened lifespan. At the cellular level, mice lacking the encoded protein exhibit accumulation of autofluorescent lipopigments. Mutations in the human ortholog of this gene cause classical late-infantile neuronal ceroid lipofuscinosis. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for targeted mutations exhibit progressive motor defects, reduced lifespan, and respiratory difficulty. One mutation also shows extensive neuronal degeneration and an accumulation of lysosomal storage material. Mice homozygous for a different allele exhibit prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930558K02Rik T A 1: 161,949,642 R115S probably benign Het
Adgre1 A G 17: 57,445,018 K589E probably benign Het
Adgrv1 A T 13: 81,182,774 L74Q probably damaging Het
Avil A G 10: 127,006,582 I77V probably benign Het
Best2 T C 8: 85,013,267 E57G probably benign Het
C87977 A G 4: 144,207,413 S375P probably damaging Het
Cacna1a T C 8: 84,569,952 C1200R probably damaging Het
Catsperb T A 12: 101,549,839 I578K probably damaging Het
Chsy1 A G 7: 66,125,385 Y154C probably damaging Het
Chuk A G 19: 44,101,831 V74A probably damaging Het
Ckb T C 12: 111,671,814 S49G probably damaging Het
Crtac1 A G 19: 42,283,609 Y632H unknown Het
Ern1 C A 11: 106,405,815 E770* probably null Het
Fam114a2 A C 11: 57,487,589 V450G probably benign Het
Fgf15 C T 7: 144,899,769 Q125* probably null Het
Frem2 A T 3: 53,551,341 S2036T probably damaging Het
Fxr2 G A 11: 69,649,204 V296I probably benign Het
Gm15264 C A 3: 94,733,429 noncoding transcript Het
Gm340 T A 19: 41,585,202 W799R probably damaging Het
Ifi213 A T 1: 173,594,015 S103T probably benign Het
Igkv5-37 T A 6: 69,963,488 Q57H probably damaging Het
Il1rap A G 16: 26,712,219 Y435C probably damaging Het
Kl T A 5: 150,988,853 M689K possibly damaging Het
Lnp1 C T 16: 56,917,372 E118K probably benign Het
Lrif1 A C 3: 106,732,327 K243Q possibly damaging Het
Lrp1b G T 2: 40,875,153 probably null Het
Lvrn G A 18: 46,884,432 V610I probably benign Het
Med1 T C 11: 98,183,853 K67R possibly damaging Het
Midn T C 10: 80,154,457 S278P probably damaging Het
Nrap A G 19: 56,389,453 V35A possibly damaging Het
Nynrin A T 14: 55,854,323 Q32L possibly damaging Het
Olfr1265 C T 2: 90,037,516 A199V probably benign Het
Olfr1328 A G 4: 118,934,431 L139P probably damaging Het
Olfr1444 A T 19: 12,862,359 I195F probably benign Het
Olfr2 T C 7: 107,001,600 I87V probably benign Het
Olfr218 G T 1: 173,204,015 V220F probably benign Het
Oog1 C T 12: 87,606,273 T113I possibly damaging Het
Otogl C T 10: 107,881,453 V386I probably benign Het
Patj A G 4: 98,424,325 N300S possibly damaging Het
Pcdhb16 T A 18: 37,479,155 D389E possibly damaging Het
Pdcd6ip T C 9: 113,659,871 I699V probably benign Het
Pfas A G 11: 68,991,945 V790A probably benign Het
Plppr4 A T 3: 117,322,394 C605S probably benign Het
Ppl G A 16: 5,107,596 Q60* probably null Het
Ppp1r1c A G 2: 79,756,466 K52R possibly damaging Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Rpe65 G A 3: 159,614,143 E217K probably benign Het
Rufy4 T C 1: 74,147,733 I560T probably benign Het
Ryr2 T C 13: 11,669,017 S3054G probably benign Het
Serpinb6a A T 13: 33,918,360 L273H probably damaging Het
Sf3b1 A T 1: 55,007,507 W293R probably damaging Het
Sik1 A T 17: 31,848,797 S435T possibly damaging Het
Slc2a12 G T 10: 22,664,502 M85I probably benign Het
Stk36 T C 1: 74,634,229 S1094P probably benign Het
Tctn1 A T 5: 122,246,586 Y393N probably benign Het
Tex9 C T 9: 72,462,000 probably null Het
Thbs2 A G 17: 14,679,680 probably null Het
Tmprss7 A T 16: 45,673,905 C412* probably null Het
Trim25 T A 11: 89,015,536 V387D probably benign Het
Usp45 A C 4: 21,810,797 D331A probably damaging Het
Vill T G 9: 119,058,414 V82G possibly damaging Het
Vmn1r189 T C 13: 22,101,884 D261G probably benign Het
Vmn2r111 G A 17: 22,548,815 T567I probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r60 A G 7: 42,136,976 Y401C probably damaging Het
Zc3h11a G A 1: 133,638,875 R69* probably null Het
Other mutations in Tpp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01480:Tpp1 APN 7 105749053 missense probably damaging 1.00
IGL01520:Tpp1 APN 7 105747729 missense probably benign 0.32
IGL01796:Tpp1 APN 7 105747650 unclassified probably benign
IGL01797:Tpp1 APN 7 105749252 missense probably benign 0.07
IGL01923:Tpp1 APN 7 105751650 missense probably benign 0.34
IGL02400:Tpp1 APN 7 105747031 missense possibly damaging 0.91
IGL02411:Tpp1 APN 7 105749619 missense probably damaging 1.00
IGL02423:Tpp1 APN 7 105749700 missense probably damaging 1.00
IGL02672:Tpp1 APN 7 105746961 missense probably benign
IGL03180:Tpp1 APN 7 105746649 missense probably benign
R0709:Tpp1 UTSW 7 105749607 missense probably benign 0.19
R0711:Tpp1 UTSW 7 105749419 missense probably damaging 1.00
R1222:Tpp1 UTSW 7 105746741 missense probably benign 0.05
R1673:Tpp1 UTSW 7 105747673 missense probably damaging 0.99
R1799:Tpp1 UTSW 7 105750308 missense probably benign 0.00
R1822:Tpp1 UTSW 7 105749647 missense probably benign
R1984:Tpp1 UTSW 7 105751698 missense probably benign 0.04
R2109:Tpp1 UTSW 7 105749970 missense probably damaging 1.00
R4304:Tpp1 UTSW 7 105750309 missense possibly damaging 0.70
R4618:Tpp1 UTSW 7 105751706 missense probably benign 0.05
R4746:Tpp1 UTSW 7 105748951 missense probably damaging 1.00
R4764:Tpp1 UTSW 7 105749251 missense probably damaging 1.00
R4837:Tpp1 UTSW 7 105746649 missense probably benign
R4855:Tpp1 UTSW 7 105746723 missense probably benign
R5015:Tpp1 UTSW 7 105752025 unclassified probably benign
R5677:Tpp1 UTSW 7 105747536 missense probably damaging 1.00
R5916:Tpp1 UTSW 7 105749380 missense probably damaging 0.97
R6291:Tpp1 UTSW 7 105747016 missense probably benign 0.05
R6422:Tpp1 UTSW 7 105746956 missense probably benign 0.01
R6671:Tpp1 UTSW 7 105749607 missense probably benign 0.19
R6841:Tpp1 UTSW 7 105748964 missense probably damaging 0.96
R6851:Tpp1 UTSW 7 105749712 missense probably damaging 1.00
R7022:Tpp1 UTSW 7 105748922 missense probably damaging 1.00
R7106:Tpp1 UTSW 7 105749911 missense possibly damaging 0.67
R7260:Tpp1 UTSW 7 105747497 missense probably benign 0.00
R7485:Tpp1 UTSW 7 105749544 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAGTATGAGTATTGGCCAGC -3'
(R):5'- CACACATCTTGGAGGTCACC -3'

Sequencing Primer
(F):5'- GCAGCCTGCTCAGCAAG -3'
(R):5'- AATGTCCTACAGCTGGATCTCATGG -3'
Posted On2017-10-10