Incidental Mutation 'R6149:Ern1'
ID489087
Institutional Source Beutler Lab
Gene Symbol Ern1
Ensembl Gene ENSMUSG00000020715
Gene Nameendoplasmic reticulum (ER) to nucleus signalling 1
SynonymsIre1a, Ire1alpha, 9030414B18Rik, Ire1p
MMRRC Submission 044296-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6149 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location106394650-106487852 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 106405815 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 770 (E770*)
Ref Sequence ENSEMBL: ENSMUSP00000001059 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001059]
PDB Structure
Crystal structure of murine IRE1 in complex with MKC9989 inhibitor [X-RAY DIFFRACTION]
Crystal structure of murine IRE1 in complex with OICR464 inhibitor [X-RAY DIFFRACTION]
Crystal structure of murine IRE1 in complex with OICR573 inhibitor [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000001059
AA Change: E770*
SMART Domains Protein: ENSMUSP00000001059
Gene: ENSMUSG00000020715
AA Change: E770*

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PQQ 28 59 3.46e-5 SMART
PQQ 110 142 1.11e-3 SMART
PQQ 148 180 7.84e-4 SMART
PQQ 191 223 3.26e-1 SMART
PQQ 279 310 5.01e1 SMART
low complexity region 471 501 N/A INTRINSIC
low complexity region 513 551 N/A INTRINSIC
Pfam:Pkinase 571 832 1.8e-44 PFAM
Pfam:Pkinase_Tyr 572 829 8.7e-26 PFAM
PUG 895 952 5.25e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131895
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the ER to nucleus signalling 1 protein, a human homologue of the yeast Ire1 gene product. This protein possesses intrinsic kinase activity and an endoribonuclease activity and it is important in altering gene expression as a response to endoplasmic reticulum-based stress signals. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for null mutations display embryonic lethality during organogenesis. Homozygous mice may also display decreased embryo size, impaired hematopoiesis, and/or placental abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930558K02Rik T A 1: 161,949,642 R115S probably benign Het
Adgre1 A G 17: 57,445,018 K589E probably benign Het
Adgrv1 A T 13: 81,182,774 L74Q probably damaging Het
Avil A G 10: 127,006,582 I77V probably benign Het
Best2 T C 8: 85,013,267 E57G probably benign Het
C87977 A G 4: 144,207,413 S375P probably damaging Het
Cacna1a T C 8: 84,569,952 C1200R probably damaging Het
Catsperb T A 12: 101,549,839 I578K probably damaging Het
Chsy1 A G 7: 66,125,385 Y154C probably damaging Het
Chuk A G 19: 44,101,831 V74A probably damaging Het
Ckb T C 12: 111,671,814 S49G probably damaging Het
Crtac1 A G 19: 42,283,609 Y632H unknown Het
Fam114a2 A C 11: 57,487,589 V450G probably benign Het
Fgf15 C T 7: 144,899,769 Q125* probably null Het
Frem2 A T 3: 53,551,341 S2036T probably damaging Het
Fxr2 G A 11: 69,649,204 V296I probably benign Het
Gm15264 C A 3: 94,733,429 noncoding transcript Het
Gm340 T A 19: 41,585,202 W799R probably damaging Het
Ifi213 A T 1: 173,594,015 S103T probably benign Het
Igkv5-37 T A 6: 69,963,488 Q57H probably damaging Het
Il1rap A G 16: 26,712,219 Y435C probably damaging Het
Kl T A 5: 150,988,853 M689K possibly damaging Het
Lnp1 C T 16: 56,917,372 E118K probably benign Het
Lrif1 A C 3: 106,732,327 K243Q possibly damaging Het
Lrp1b G T 2: 40,875,153 probably null Het
Lvrn G A 18: 46,884,432 V610I probably benign Het
Med1 T C 11: 98,183,853 K67R possibly damaging Het
Midn T C 10: 80,154,457 S278P probably damaging Het
Nrap A G 19: 56,389,453 V35A possibly damaging Het
Nynrin A T 14: 55,854,323 Q32L possibly damaging Het
Olfr1265 C T 2: 90,037,516 A199V probably benign Het
Olfr1328 A G 4: 118,934,431 L139P probably damaging Het
Olfr1444 A T 19: 12,862,359 I195F probably benign Het
Olfr2 T C 7: 107,001,600 I87V probably benign Het
Olfr218 G T 1: 173,204,015 V220F probably benign Het
Oog1 C T 12: 87,606,273 T113I possibly damaging Het
Otogl C T 10: 107,881,453 V386I probably benign Het
Patj A G 4: 98,424,325 N300S possibly damaging Het
Pcdhb16 T A 18: 37,479,155 D389E possibly damaging Het
Pdcd6ip T C 9: 113,659,871 I699V probably benign Het
Pfas A G 11: 68,991,945 V790A probably benign Het
Plppr4 A T 3: 117,322,394 C605S probably benign Het
Ppl G A 16: 5,107,596 Q60* probably null Het
Ppp1r1c A G 2: 79,756,466 K52R possibly damaging Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Rpe65 G A 3: 159,614,143 E217K probably benign Het
Rufy4 T C 1: 74,147,733 I560T probably benign Het
Ryr2 T C 13: 11,669,017 S3054G probably benign Het
Serpinb6a A T 13: 33,918,360 L273H probably damaging Het
Sf3b1 A T 1: 55,007,507 W293R probably damaging Het
Sik1 A T 17: 31,848,797 S435T possibly damaging Het
Slc2a12 G T 10: 22,664,502 M85I probably benign Het
Stk36 T C 1: 74,634,229 S1094P probably benign Het
Tctn1 A T 5: 122,246,586 Y393N probably benign Het
Tex9 C T 9: 72,462,000 probably null Het
Thbs2 A G 17: 14,679,680 probably null Het
Tmprss7 A T 16: 45,673,905 C412* probably null Het
Tpp1 T C 7: 105,747,727 T399A probably benign Het
Trim25 T A 11: 89,015,536 V387D probably benign Het
Usp45 A C 4: 21,810,797 D331A probably damaging Het
Vill T G 9: 119,058,414 V82G possibly damaging Het
Vmn1r189 T C 13: 22,101,884 D261G probably benign Het
Vmn2r111 G A 17: 22,548,815 T567I probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r60 A G 7: 42,136,976 Y401C probably damaging Het
Zc3h11a G A 1: 133,638,875 R69* probably null Het
Other mutations in Ern1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00825:Ern1 APN 11 106421967 missense probably benign 0.02
IGL01938:Ern1 APN 11 106411657 missense probably benign
IGL02813:Ern1 APN 11 106423425 missense probably damaging 1.00
IGL02928:Ern1 APN 11 106405879 splice site probably benign
IGL02931:Ern1 APN 11 106423440 missense probably damaging 1.00
IGL03153:Ern1 APN 11 106410098 missense possibly damaging 0.63
Immoderate UTSW 11 106420042 missense possibly damaging 0.93
Militant UTSW 11 106411652 missense probably damaging 1.00
K7371:Ern1 UTSW 11 106400275 missense probably damaging 1.00
R0090:Ern1 UTSW 11 106405823 missense probably damaging 1.00
R0391:Ern1 UTSW 11 106407178 nonsense probably null
R0411:Ern1 UTSW 11 106398586 missense probably benign
R0627:Ern1 UTSW 11 106398693 missense probably benign 0.00
R1416:Ern1 UTSW 11 106421980 splice site probably benign
R1831:Ern1 UTSW 11 106399842 splice site probably null
R1837:Ern1 UTSW 11 106458957 missense probably damaging 1.00
R1944:Ern1 UTSW 11 106421950 missense probably damaging 1.00
R1945:Ern1 UTSW 11 106421950 missense probably damaging 1.00
R1954:Ern1 UTSW 11 106421974 splice site probably benign
R1957:Ern1 UTSW 11 106426897 missense probably damaging 1.00
R2192:Ern1 UTSW 11 106409924 missense probably benign
R4276:Ern1 UTSW 11 106407181 missense probably benign
R4277:Ern1 UTSW 11 106407181 missense probably benign
R4471:Ern1 UTSW 11 106420042 missense possibly damaging 0.93
R4583:Ern1 UTSW 11 106407205 missense probably damaging 1.00
R4731:Ern1 UTSW 11 106434850 intron probably benign
R5177:Ern1 UTSW 11 106411775 missense probably benign 0.01
R5489:Ern1 UTSW 11 106407529 missense probably damaging 1.00
R5538:Ern1 UTSW 11 106421901 missense possibly damaging 0.83
R5806:Ern1 UTSW 11 106398705 missense probably damaging 0.96
R5922:Ern1 UTSW 11 106421730 missense probably damaging 0.97
R5931:Ern1 UTSW 11 106426873 missense possibly damaging 0.86
R5990:Ern1 UTSW 11 106411769 missense probably benign
R6253:Ern1 UTSW 11 106426908 missense possibly damaging 0.89
R6721:Ern1 UTSW 11 106411652 missense probably damaging 1.00
R6957:Ern1 UTSW 11 106403539 missense probably damaging 1.00
R7362:Ern1 UTSW 11 106437123 missense probably damaging 1.00
R7387:Ern1 UTSW 11 106421952 missense probably damaging 0.98
R7494:Ern1 UTSW 11 106407535 missense probably damaging 1.00
R7514:Ern1 UTSW 11 106409893 critical splice donor site probably null
X0021:Ern1 UTSW 11 106398606 missense probably damaging 1.00
X0022:Ern1 UTSW 11 106458919 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTAGGCAGCCTCTGTCAG -3'
(R):5'- TGACATCAATCGGAACACTAGGG -3'

Sequencing Primer
(F):5'- AGCTCTGTATGGCTCAGCAC -3'
(R):5'- CTAGGGCAATAATTCAGGGTGTCCC -3'
Posted On2017-10-10