Incidental Mutation 'R6149:Serpinb6a'
ID489093
Institutional Source Beutler Lab
Gene Symbol Serpinb6a
Ensembl Gene ENSMUSG00000060147
Gene Nameserine (or cysteine) peptidase inhibitor, clade B, member 6a
Synonymsovalbumin, D330015H01Rik, 4930482L21Rik, Spi3
MMRRC Submission 044296-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6149 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location33917918-34002794 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 33918360 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 273 (L273H)
Ref Sequence ENSEMBL: ENSMUSP00000131115 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017188] [ENSMUST00000043552] [ENSMUST00000076532] [ENSMUST00000167163] [ENSMUST00000167260] [ENSMUST00000168350] [ENSMUST00000171034] [ENSMUST00000171252]
Predicted Effect probably damaging
Transcript: ENSMUST00000017188
AA Change: L294H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000017188
Gene: ENSMUSG00000060147
AA Change: L294H

DomainStartEndE-ValueType
SERPIN 34 399 2.84e-179 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000043552
AA Change: L273H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041016
Gene: ENSMUSG00000060147
AA Change: L273H

DomainStartEndE-ValueType
SERPIN 13 378 2.84e-179 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000076532
AA Change: L273H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075848
Gene: ENSMUSG00000060147
AA Change: L273H

DomainStartEndE-ValueType
SERPIN 13 378 2.84e-179 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167163
AA Change: L273H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131115
Gene: ENSMUSG00000060147
AA Change: L273H

DomainStartEndE-ValueType
SERPIN 13 378 2.84e-179 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167260
SMART Domains Protein: ENSMUSP00000127768
Gene: ENSMUSG00000060147

DomainStartEndE-ValueType
SERPIN 13 193 1.34e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168350
SMART Domains Protein: ENSMUSP00000130356
Gene: ENSMUSG00000060147

DomainStartEndE-ValueType
SERPIN 13 162 9.24e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171034
SMART Domains Protein: ENSMUSP00000132433
Gene: ENSMUSG00000060147

DomainStartEndE-ValueType
SERPIN 13 228 3.54e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171252
SMART Domains Protein: ENSMUSP00000126162
Gene: ENSMUSG00000060147

DomainStartEndE-ValueType
SERPIN 13 188 4.71e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171951
Meta Mutation Damage Score 0.494 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serpin (serine proteinase inhibitor) superfamily, and ovalbumin(ov)-serpin subfamily. It was originally discovered as a placental thrombin inhibitor. The mouse homolog was found to be expressed in the hair cells of the inner ear. Mutations in this gene are associated with nonsyndromic progressive hearing loss, suggesting that this serpin plays an important role in the inner ear in the protection against leakage of lysosomal content during stress, and that loss of this protection results in cell death and sensorineural hearing loss. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for a reporter allele are viable, fertile and developmentally normal, with no apparent alterations in growth, leukocyte function, or sensitivity to cerebral ischemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930558K02Rik T A 1: 161,949,642 R115S probably benign Het
Adgre1 A G 17: 57,445,018 K589E probably benign Het
Adgrv1 A T 13: 81,182,774 L74Q probably damaging Het
Avil A G 10: 127,006,582 I77V probably benign Het
Best2 T C 8: 85,013,267 E57G probably benign Het
C87977 A G 4: 144,207,413 S375P probably damaging Het
Cacna1a T C 8: 84,569,952 C1200R probably damaging Het
Catsperb T A 12: 101,549,839 I578K probably damaging Het
Chsy1 A G 7: 66,125,385 Y154C probably damaging Het
Chuk A G 19: 44,101,831 V74A probably damaging Het
Ckb T C 12: 111,671,814 S49G probably damaging Het
Crtac1 A G 19: 42,283,609 Y632H unknown Het
Ern1 C A 11: 106,405,815 E770* probably null Het
Fam114a2 A C 11: 57,487,589 V450G probably benign Het
Fgf15 C T 7: 144,899,769 Q125* probably null Het
Frem2 A T 3: 53,551,341 S2036T probably damaging Het
Fxr2 G A 11: 69,649,204 V296I probably benign Het
Gm15264 C A 3: 94,733,429 noncoding transcript Het
Gm340 T A 19: 41,585,202 W799R probably damaging Het
Ifi213 A T 1: 173,594,015 S103T probably benign Het
Igkv5-37 T A 6: 69,963,488 Q57H probably damaging Het
Il1rap A G 16: 26,712,219 Y435C probably damaging Het
Kl T A 5: 150,988,853 M689K possibly damaging Het
Lnp1 C T 16: 56,917,372 E118K probably benign Het
Lrif1 A C 3: 106,732,327 K243Q possibly damaging Het
Lrp1b G T 2: 40,875,153 probably null Het
Lvrn G A 18: 46,884,432 V610I probably benign Het
Med1 T C 11: 98,183,853 K67R possibly damaging Het
Midn T C 10: 80,154,457 S278P probably damaging Het
Nrap A G 19: 56,389,453 V35A possibly damaging Het
Nynrin A T 14: 55,854,323 Q32L possibly damaging Het
Olfr1265 C T 2: 90,037,516 A199V probably benign Het
Olfr1328 A G 4: 118,934,431 L139P probably damaging Het
Olfr1444 A T 19: 12,862,359 I195F probably benign Het
Olfr2 T C 7: 107,001,600 I87V probably benign Het
Olfr218 G T 1: 173,204,015 V220F probably benign Het
Oog1 C T 12: 87,606,273 T113I possibly damaging Het
Otogl C T 10: 107,881,453 V386I probably benign Het
Patj A G 4: 98,424,325 N300S possibly damaging Het
Pcdhb16 T A 18: 37,479,155 D389E possibly damaging Het
Pdcd6ip T C 9: 113,659,871 I699V probably benign Het
Pfas A G 11: 68,991,945 V790A probably benign Het
Plppr4 A T 3: 117,322,394 C605S probably benign Het
Ppl G A 16: 5,107,596 Q60* probably null Het
Ppp1r1c A G 2: 79,756,466 K52R possibly damaging Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Rpe65 G A 3: 159,614,143 E217K probably benign Het
Rufy4 T C 1: 74,147,733 I560T probably benign Het
Ryr2 T C 13: 11,669,017 S3054G probably benign Het
Sf3b1 A T 1: 55,007,507 W293R probably damaging Het
Sik1 A T 17: 31,848,797 S435T possibly damaging Het
Slc2a12 G T 10: 22,664,502 M85I probably benign Het
Stk36 T C 1: 74,634,229 S1094P probably benign Het
Tctn1 A T 5: 122,246,586 Y393N probably benign Het
Tex9 C T 9: 72,462,000 probably null Het
Thbs2 A G 17: 14,679,680 probably null Het
Tmprss7 A T 16: 45,673,905 C412* probably null Het
Tpp1 T C 7: 105,747,727 T399A probably benign Het
Trim25 T A 11: 89,015,536 V387D probably benign Het
Usp45 A C 4: 21,810,797 D331A probably damaging Het
Vill T G 9: 119,058,414 V82G possibly damaging Het
Vmn1r189 T C 13: 22,101,884 D261G probably benign Het
Vmn2r111 G A 17: 22,548,815 T567I probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r60 A G 7: 42,136,976 Y401C probably damaging Het
Zc3h11a G A 1: 133,638,875 R69* probably null Het
Other mutations in Serpinb6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Serpinb6a APN 13 33931512 missense possibly damaging 0.54
IGL01356:Serpinb6a APN 13 33925417 missense possibly damaging 0.76
IGL01458:Serpinb6a APN 13 33930081 missense possibly damaging 0.56
IGL01539:Serpinb6a APN 13 33930134 missense probably damaging 1.00
IGL02795:Serpinb6a APN 13 33931593 missense probably damaging 1.00
IGL02885:Serpinb6a APN 13 33918799 missense probably benign 0.11
IGL02971:Serpinb6a APN 13 33931470 critical splice donor site probably null
R0829:Serpinb6a UTSW 13 33935701 utr 5 prime probably benign
R1324:Serpinb6a UTSW 13 33918360 missense probably damaging 1.00
R2232:Serpinb6a UTSW 13 33925320 missense probably damaging 0.97
R3498:Serpinb6a UTSW 13 33918781 missense probably damaging 0.99
R4982:Serpinb6a UTSW 13 33918874 missense probably damaging 0.99
R5131:Serpinb6a UTSW 13 33918872 missense probably benign 0.42
R5132:Serpinb6a UTSW 13 33918322 missense probably benign 0.00
R6427:Serpinb6a UTSW 13 33918259 missense probably damaging 0.99
R6937:Serpinb6a UTSW 13 33918818 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TGCACCTCACCGTCATCATG -3'
(R):5'- ATAATAGGTTACAGCCACACTTCCC -3'

Sequencing Primer
(F):5'- TCATCATGCCAGCTGTAGCAG -3'
(R):5'- CCCTGGGCACTGTAGAATGTTAC -3'
Posted On2017-10-10