Incidental Mutation 'R6151:Col6a3'
ID489218
Institutional Source Beutler Lab
Gene Symbol Col6a3
Ensembl Gene ENSMUSG00000048126
Gene Namecollagen, type VI, alpha 3
SynonymsCol6a-3
MMRRC Submission 044298-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6151 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location90765923-90843971 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 90813753 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 652 (N652K)
Ref Sequence ENSEMBL: ENSMUSP00000057131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056925] [ENSMUST00000097653] [ENSMUST00000130846] [ENSMUST00000188587]
PDB Structure
Crystal structure of the Collagen VI alpha3 N5 domain [X-RAY DIFFRACTION]
Crystal structure of the Collagen VI alpha3 N5 domain R1061Q [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000056925
AA Change: N652K

PolyPhen 2 Score 0.534 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000057131
Gene: ENSMUSG00000048126
AA Change: N652K

DomainStartEndE-ValueType
VWA 36 214 3.58e-42 SMART
VWA 239 415 3.34e-42 SMART
VWA 442 617 7.27e-43 SMART
VWA 636 813 7.8e-43 SMART
VWA 834 1010 4.21e-39 SMART
VWA 1024 1203 3.02e-40 SMART
VWA 1228 1406 1.1e-42 SMART
VWA 1431 1604 9.17e-40 SMART
VWA 1634 1807 1.78e-37 SMART
VWA 1833 2022 7.92e-3 SMART
Pfam:Collagen 2033 2094 2e-10 PFAM
Pfam:Collagen 2077 2142 2.8e-10 PFAM
low complexity region 2179 2222 N/A INTRINSIC
low complexity region 2228 2279 N/A INTRINSIC
Pfam:Collagen 2311 2373 7.9e-11 PFAM
VWA 2397 2576 3.95e-21 SMART
VWA 2614 2813 2.25e-25 SMART
low complexity region 2864 2880 N/A INTRINSIC
low complexity region 2886 2900 N/A INTRINSIC
low complexity region 2903 2941 N/A INTRINSIC
low complexity region 2945 3024 N/A INTRINSIC
low complexity region 3039 3076 N/A INTRINSIC
low complexity region 3091 3103 N/A INTRINSIC
FN3 3104 3183 4.6e-1 SMART
KU 3226 3279 4.34e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097653
SMART Domains Protein: ENSMUSP00000137585
Gene: ENSMUSG00000048126

DomainStartEndE-ValueType
VWA 35 210 7.27e-43 SMART
VWA 227 403 4.21e-39 SMART
VWA 417 596 3.02e-40 SMART
VWA 621 799 1.1e-42 SMART
VWA 824 997 9.17e-40 SMART
VWA 1027 1200 1.78e-37 SMART
VWA 1226 1415 7.92e-3 SMART
Pfam:Collagen 1426 1486 9.2e-10 PFAM
Pfam:Collagen 1473 1539 2.2e-9 PFAM
low complexity region 1572 1615 N/A INTRINSIC
low complexity region 1621 1672 N/A INTRINSIC
low complexity region 1690 1704 N/A INTRINSIC
low complexity region 1713 1734 N/A INTRINSIC
VWA 1790 1969 3.95e-21 SMART
VWA 2007 2206 2.25e-25 SMART
low complexity region 2257 2273 N/A INTRINSIC
low complexity region 2279 2293 N/A INTRINSIC
low complexity region 2296 2334 N/A INTRINSIC
low complexity region 2338 2417 N/A INTRINSIC
low complexity region 2432 2469 N/A INTRINSIC
low complexity region 2484 2496 N/A INTRINSIC
FN3 2497 2576 4.6e-1 SMART
KU 2619 2672 4.34e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130846
AA Change: N652K

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000115210
Gene: ENSMUSG00000048126
AA Change: N652K

DomainStartEndE-ValueType
VWA 36 214 3.58e-42 SMART
VWA 239 415 3.34e-42 SMART
VWA 442 617 7.27e-43 SMART
VWA 636 813 7.8e-43 SMART
VWA 834 1010 4.21e-39 SMART
VWA 1024 1203 3.02e-40 SMART
VWA 1228 1406 1.1e-42 SMART
VWA 1431 1604 9.17e-40 SMART
Pfam:VWA 1636 1703 1.4e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188587
SMART Domains Protein: ENSMUSP00000140858
Gene: ENSMUSG00000048126

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
VWA 35 210 4.7e-45 SMART
VWA 227 403 2.7e-41 SMART
VWA 417 596 2e-42 SMART
VWA 621 799 7e-45 SMART
VWA 824 997 5.8e-42 SMART
VWA 1027 1200 1.1e-39 SMART
VWA 1226 1415 4.8e-5 SMART
Pfam:Collagen 1426 1486 3.8e-8 PFAM
Pfam:Collagen 1473 1539 9.1e-8 PFAM
low complexity region 1572 1615 N/A INTRINSIC
low complexity region 1621 1672 N/A INTRINSIC
low complexity region 1690 1704 N/A INTRINSIC
low complexity region 1713 1734 N/A INTRINSIC
VWA 1790 1969 2.4e-23 SMART
VWA 2007 2206 1.4e-27 SMART
low complexity region 2257 2273 N/A INTRINSIC
low complexity region 2279 2293 N/A INTRINSIC
low complexity region 2296 2334 N/A INTRINSIC
low complexity region 2338 2417 N/A INTRINSIC
low complexity region 2432 2469 N/A INTRINSIC
low complexity region 2484 2496 N/A INTRINSIC
FN3 2497 2576 2.2e-3 SMART
KU 2619 2672 2.1e-26 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha-3 chain, one of the three alpha chains of type VI collagen, a beaded filament collagen found in most connective tissues. The alpha-3 chain of type VI collagen is much larger than the alpha-1 and -2 chains. This difference in size is largely due to an increase in the number of subdomains, similar to von Willebrand Factor type A domains, that are found in the amino terminal globular domain of all the alpha chains. These domains have been shown to bind extracellular matrix proteins, an interaction that explains the importance of this collagen in organizing matrix components. Mutations in the type VI collagen genes are associated with Bethlem myopathy, a rare autosomal dominant proximal myopathy with early childhood onset. Mutations in this gene are also a cause of Ullrich congenital muscular dystrophy, also referred to as Ullrich scleroatonic muscular dystrophy, an autosomal recessive congenital myopathy that is more severe than Bethlem myopathy. Multiple transcript variants have been identified, but the full-length nature of only some of these variants has been described. [provided by RefSeq, Jun 2009]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit mild myopathy, decreased skeletal muscle weight, increased collagen deposition in muscles, skeletal muscle interstitial fibrosis and abnormal tendon collagen fibril morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A T 13: 66,431,681 C248S probably damaging Het
3110009E18Rik A G 1: 120,171,486 probably null Het
4930550C14Rik G T 9: 53,414,383 R73S probably damaging Het
Abca1 A G 4: 53,085,261 V517A probably benign Het
Adck5 A T 15: 76,594,687 K370N possibly damaging Het
Akap6 A C 12: 53,025,792 D981A probably damaging Het
Apbb1 G A 7: 105,574,252 R51* probably null Het
Arhgap23 A G 11: 97,500,412 M1252V probably benign Het
Arhgef1 A G 7: 24,917,942 T354A probably benign Het
Arid1a G T 4: 133,684,976 Q1636K unknown Het
Asmt C T X: 170,676,467 A237V possibly damaging Het
Brat1 T A 5: 140,705,961 C43S probably benign Het
Cd36 T C 5: 17,795,595 Y370C probably damaging Het
Ceacam12 A T 7: 18,069,105 L145F probably benign Het
Col24a1 C T 3: 145,314,054 T62I probably damaging Het
Dcbld1 T C 10: 52,304,660 L140P probably damaging Het
Dhrs13 G A 11: 78,036,982 C218Y probably damaging Het
Diaph1 T G 18: 37,853,353 E1158A probably damaging Het
Emp2 A C 16: 10,292,281 F20C probably damaging Het
Enpep T C 3: 129,332,418 I22V possibly damaging Het
Epha2 A G 4: 141,318,480 probably null Het
Eprs G T 1: 185,407,754 probably null Het
Etl4 T A 2: 20,713,360 I304N probably damaging Het
Exoc3l2 C A 7: 19,491,745 S89* probably null Het
F5 A T 1: 164,181,635 I325F probably damaging Het
F5 G A 1: 164,190,187 C611Y probably damaging Het
Fam133b A T 5: 3,559,133 S116C probably null Het
Fam13b A T 18: 34,494,277 D190E probably damaging Het
Fam169a T G 13: 97,093,630 Y58D probably damaging Het
Far1 G A 7: 113,561,396 R383H possibly damaging Het
Fnbp1l T C 3: 122,570,930 K52R possibly damaging Het
Foxj3 C A 4: 119,623,271 Q469K unknown Het
Frs3 A T 17: 47,689,088 probably benign Het
Gdpd3 A G 7: 126,775,502 S290G probably benign Het
Gm6768 T G 12: 119,261,106 noncoding transcript Het
Gmip T A 8: 69,817,085 L610Q probably damaging Het
Gprc5c T A 11: 114,864,025 I176N probably damaging Het
Grm3 A G 5: 9,511,556 F765L probably damaging Het
Hhat A T 1: 192,759,757 L2Q probably damaging Het
Hrasls5 C T 19: 7,619,291 P148S probably damaging Het
Hspbap1 T C 16: 35,817,222 S214P probably damaging Het
Ighv1-62-3 C A 12: 115,461,289 V21F probably damaging Het
Kcnj15 A T 16: 95,295,668 K50* probably null Het
Kidins220 T C 12: 25,056,909 S1454P possibly damaging Het
Kl T A 5: 150,988,853 M689K possibly damaging Het
Klhl23 T G 2: 69,824,854 L356R probably damaging Het
Kndc1 A T 7: 139,921,213 D806V probably benign Het
Krt26 T C 11: 99,337,489 E139G probably benign Het
Lefty1 T C 1: 180,935,116 F3L unknown Het
Madd A C 2: 91,165,457 Y853* probably null Het
Map1a T A 2: 121,289,823 D63E probably benign Het
Mdn1 T A 4: 32,684,735 V815E probably damaging Het
Mettl3 A G 14: 52,295,020 Y569H probably damaging Het
Mknk2 T C 10: 80,669,025 probably null Het
Mpp3 C A 11: 102,008,566 R376S probably benign Het
Nup160 T A 2: 90,690,105 Y293* probably null Het
Nupl1 A T 14: 60,244,616 F100I possibly damaging Het
Nxpe2 A C 9: 48,326,191 L255V probably benign Het
Olfr1423 T C 19: 12,036,736 E2G probably benign Het
Olfr167 A T 16: 19,515,531 L35Q probably damaging Het
Olfr390 T A 11: 73,787,695 Y252* probably null Het
Olfr479 A G 7: 108,055,899 I306V probably benign Het
Padi3 A T 4: 140,796,394 D248E probably damaging Het
Paxip1 G T 5: 27,761,618 H637N probably damaging Het
Pde4b T A 4: 102,601,551 M296K probably damaging Het
Pkd1 A G 17: 24,575,606 H2089R probably benign Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Rhebl1 T C 15: 98,878,279 I165V probably benign Het
Rock1 A T 18: 10,106,426 V481E possibly damaging Het
Rtca T A 3: 116,507,827 T24S probably benign Het
Serpina3c T A 12: 104,152,068 I4F possibly damaging Het
Serpina3j C A 12: 104,317,390 A249E possibly damaging Het
Slc38a9 A G 13: 112,689,376 N116S probably damaging Het
Slco2b1 C T 7: 99,690,563 V58I possibly damaging Het
Slfn8 T A 11: 83,017,321 Y132F probably damaging Het
Smg6 T G 11: 75,156,207 I1242S probably damaging Het
Tap2 G T 17: 34,212,047 V374L probably benign Het
Tbc1d10b G A 7: 127,207,996 T123M probably damaging Het
Tenm2 A C 11: 36,008,783 V2516G probably damaging Het
Tenm3 C T 8: 48,395,573 R12Q probably damaging Het
Tmem130 T A 5: 144,737,851 M355L probably benign Het
Tns4 C T 11: 99,075,550 S433N probably benign Het
Traip G T 9: 107,970,619 probably null Het
Trmo G A 4: 46,389,390 R2C probably damaging Het
Ttn A T 2: 76,944,160 I2134N probably damaging Het
Uba1y A G Y: 825,984 D380G probably benign Het
Ube2t T A 1: 134,967,960 probably null Het
Ugdh A T 5: 65,417,581 Y367* probably null Het
Usp45 A C 4: 21,810,797 D331A probably damaging Het
Vmn1r84 G T 7: 12,361,914 T284K possibly damaging Het
Vmn1r91 T A 7: 20,101,435 F93Y probably benign Het
Vmn2r77 T A 7: 86,801,670 Y255N probably benign Het
Vmn2r96 A T 17: 18,583,959 Q490H probably benign Het
Vwa2 A G 19: 56,903,465 probably null Het
Vwf A G 6: 125,657,065 K169E unknown Het
Zc3h7b G C 15: 81,778,710 probably null Het
Zfp458 T A 13: 67,257,598 H259L possibly damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zfp804b A G 5: 6,769,910 V1051A probably benign Het
Other mutations in Col6a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Col6a3 APN 1 90828255 missense probably damaging 1.00
IGL00425:Col6a3 APN 1 90782026 missense unknown
IGL00541:Col6a3 APN 1 90802142 missense possibly damaging 0.83
IGL01063:Col6a3 APN 1 90802332 missense probably damaging 1.00
IGL01094:Col6a3 APN 1 90803933 missense possibly damaging 0.93
IGL01138:Col6a3 APN 1 90807510 missense probably damaging 1.00
IGL01291:Col6a3 APN 1 90802292 missense probably damaging 1.00
IGL01674:Col6a3 APN 1 90802514 missense probably damaging 1.00
IGL01756:Col6a3 APN 1 90779162 missense unknown
IGL01827:Col6a3 APN 1 90802319 missense probably damaging 1.00
IGL01845:Col6a3 APN 1 90796571 missense probably damaging 1.00
IGL01869:Col6a3 APN 1 90773048 missense unknown
IGL01900:Col6a3 APN 1 90795010 critical splice donor site probably null
IGL01925:Col6a3 APN 1 90802236 missense possibly damaging 0.95
IGL02002:Col6a3 APN 1 90782136 splice site probably benign
IGL02115:Col6a3 APN 1 90807651 missense probably damaging 0.99
IGL02302:Col6a3 APN 1 90781760 missense unknown
IGL02313:Col6a3 APN 1 90811606 missense probably damaging 1.00
IGL02458:Col6a3 APN 1 90779197 missense unknown
IGL02821:Col6a3 APN 1 90803878 missense probably damaging 1.00
IGL02828:Col6a3 APN 1 90796559 missense probably damaging 1.00
IGL03112:Col6a3 APN 1 90811520 nonsense probably null
IGL03129:Col6a3 APN 1 90821862 missense probably damaging 1.00
IGL03132:Col6a3 APN 1 90803893 missense probably damaging 1.00
IGL03148:Col6a3 APN 1 90827866 missense probably benign 0.33
IGL03251:Col6a3 APN 1 90810176 missense probably damaging 1.00
ANU05:Col6a3 UTSW 1 90802292 missense probably damaging 1.00
IGL03048:Col6a3 UTSW 1 90810248 missense possibly damaging 0.58
R0020:Col6a3 UTSW 1 90811550 missense probably damaging 0.99
R0020:Col6a3 UTSW 1 90811550 missense probably damaging 0.99
R0033:Col6a3 UTSW 1 90802245 missense probably damaging 1.00
R0033:Col6a3 UTSW 1 90802245 missense probably damaging 1.00
R0105:Col6a3 UTSW 1 90798161 missense possibly damaging 0.65
R0116:Col6a3 UTSW 1 90813551 missense probably damaging 1.00
R0167:Col6a3 UTSW 1 90798173 missense probably damaging 1.00
R0319:Col6a3 UTSW 1 90807704 missense possibly damaging 0.95
R0348:Col6a3 UTSW 1 90828049 missense probably damaging 1.00
R0365:Col6a3 UTSW 1 90788216 missense unknown
R0512:Col6a3 UTSW 1 90821798 intron probably benign
R0564:Col6a3 UTSW 1 90807734 missense probably damaging 1.00
R0635:Col6a3 UTSW 1 90808086 splice site probably null
R0667:Col6a3 UTSW 1 90828101 missense probably damaging 0.98
R0680:Col6a3 UTSW 1 90778981 missense unknown
R0736:Col6a3 UTSW 1 90804089 missense possibly damaging 0.95
R0737:Col6a3 UTSW 1 90828298 missense probably damaging 1.00
R0747:Col6a3 UTSW 1 90802653 missense probably damaging 1.00
R1155:Col6a3 UTSW 1 90794325 missense probably null 1.00
R1169:Col6a3 UTSW 1 90822014 missense possibly damaging 0.67
R1180:Col6a3 UTSW 1 90781855 missense unknown
R1225:Col6a3 UTSW 1 90811516 missense probably damaging 1.00
R1343:Col6a3 UTSW 1 90768347 missense unknown
R1387:Col6a3 UTSW 1 90822416 intron probably benign
R1437:Col6a3 UTSW 1 90801376 missense probably damaging 1.00
R1448:Col6a3 UTSW 1 90781855 missense unknown
R1677:Col6a3 UTSW 1 90821861 missense probably benign 0.14
R1681:Col6a3 UTSW 1 90773502 missense unknown
R1711:Col6a3 UTSW 1 90830213 missense probably damaging 1.00
R1727:Col6a3 UTSW 1 90796574 critical splice acceptor site probably null
R1736:Col6a3 UTSW 1 90779059 missense unknown
R1738:Col6a3 UTSW 1 90816361 missense probably damaging 1.00
R1742:Col6a3 UTSW 1 90813794 missense probably damaging 1.00
R1809:Col6a3 UTSW 1 90827949 missense probably damaging 1.00
R1851:Col6a3 UTSW 1 90807534 missense possibly damaging 0.69
R1852:Col6a3 UTSW 1 90807534 missense possibly damaging 0.69
R1872:Col6a3 UTSW 1 90830214 missense probably damaging 0.96
R1889:Col6a3 UTSW 1 90803711 missense probably benign 0.00
R1895:Col6a3 UTSW 1 90803711 missense probably benign 0.00
R1908:Col6a3 UTSW 1 90811699 missense probably damaging 1.00
R1919:Col6a3 UTSW 1 90822359 missense possibly damaging 0.66
R1973:Col6a3 UTSW 1 90804175 missense probably damaging 1.00
R2083:Col6a3 UTSW 1 90782011 missense unknown
R2121:Col6a3 UTSW 1 90810365 missense probably damaging 1.00
R2197:Col6a3 UTSW 1 90803745 missense probably benign 0.09
R2448:Col6a3 UTSW 1 90813358 missense probably damaging 1.00
R2831:Col6a3 UTSW 1 90803713 missense possibly damaging 0.89
R2877:Col6a3 UTSW 1 90775599 missense unknown
R3052:Col6a3 UTSW 1 90802130 missense possibly damaging 0.71
R3104:Col6a3 UTSW 1 90816302 missense probably damaging 0.99
R3105:Col6a3 UTSW 1 90816302 missense probably damaging 0.99
R3106:Col6a3 UTSW 1 90816302 missense probably damaging 0.99
R3418:Col6a3 UTSW 1 90804091 missense probably benign 0.42
R3419:Col6a3 UTSW 1 90804091 missense probably benign 0.42
R3837:Col6a3 UTSW 1 90780081 missense unknown
R4007:Col6a3 UTSW 1 90802569 missense probably damaging 1.00
R4082:Col6a3 UTSW 1 90821883 missense probably damaging 1.00
R4181:Col6a3 UTSW 1 90807614 missense probably damaging 1.00
R4200:Col6a3 UTSW 1 90801383 missense probably benign 0.28
R4244:Col6a3 UTSW 1 90786639 missense unknown
R4297:Col6a3 UTSW 1 90811378 missense probably damaging 1.00
R4302:Col6a3 UTSW 1 90807614 missense probably damaging 1.00
R4472:Col6a3 UTSW 1 90822014 missense probably benign 0.23
R4600:Col6a3 UTSW 1 90781904 missense unknown
R4683:Col6a3 UTSW 1 90773457 missense unknown
R4788:Col6a3 UTSW 1 90772950 critical splice donor site probably null
R4851:Col6a3 UTSW 1 90779289 missense unknown
R4899:Col6a3 UTSW 1 90802427 missense probably damaging 0.99
R4904:Col6a3 UTSW 1 90801442 missense probably damaging 1.00
R4908:Col6a3 UTSW 1 90807524 missense probably damaging 1.00
R4960:Col6a3 UTSW 1 90804218 missense probably damaging 1.00
R4981:Col6a3 UTSW 1 90778843 missense unknown
R5057:Col6a3 UTSW 1 90816130 missense possibly damaging 0.91
R5062:Col6a3 UTSW 1 90779352 missense unknown
R5105:Col6a3 UTSW 1 90798140 missense possibly damaging 0.81
R5127:Col6a3 UTSW 1 90768345 missense unknown
R5166:Col6a3 UTSW 1 90810608 missense probably damaging 1.00
R5168:Col6a3 UTSW 1 90773639 nonsense probably null
R5196:Col6a3 UTSW 1 90816538 splice site probably null
R5230:Col6a3 UTSW 1 90789054 missense unknown
R5268:Col6a3 UTSW 1 90785243 missense unknown
R5381:Col6a3 UTSW 1 90775612 missense unknown
R5392:Col6a3 UTSW 1 90801295 missense probably benign 0.41
R5445:Col6a3 UTSW 1 90782039 nonsense probably null
R5571:Col6a3 UTSW 1 90788216 missense unknown
R5665:Col6a3 UTSW 1 90827880 missense probably benign 0.00
R5902:Col6a3 UTSW 1 90802199 unclassified probably null
R5914:Col6a3 UTSW 1 90776200 missense unknown
R5955:Col6a3 UTSW 1 90811441 missense probably damaging 1.00
R5977:Col6a3 UTSW 1 90821849 missense possibly damaging 0.82
R6006:Col6a3 UTSW 1 90768383 missense unknown
R6010:Col6a3 UTSW 1 90773497 missense unknown
R6025:Col6a3 UTSW 1 90828102 missense probably damaging 1.00
R6154:Col6a3 UTSW 1 90773665 missense unknown
R6181:Col6a3 UTSW 1 90816374 missense possibly damaging 0.95
R6197:Col6a3 UTSW 1 90822341 missense probably damaging 1.00
R6332:Col6a3 UTSW 1 90822233 missense probably damaging 1.00
R6362:Col6a3 UTSW 1 90810563 missense probably damaging 0.99
R6476:Col6a3 UTSW 1 90781812 missense unknown
R6484:Col6a3 UTSW 1 90791923 critical splice donor site probably null
R6701:Col6a3 UTSW 1 90792462 missense probably benign 0.14
R6702:Col6a3 UTSW 1 90779439 missense unknown
R6703:Col6a3 UTSW 1 90779439 missense unknown
R6703:Col6a3 UTSW 1 90792462 missense probably benign 0.14
R6724:Col6a3 UTSW 1 90779152 missense unknown
R6746:Col6a3 UTSW 1 90779045 missense unknown
R6797:Col6a3 UTSW 1 90804088 missense probably damaging 0.99
R6798:Col6a3 UTSW 1 90795009 splice site probably null
R6903:Col6a3 UTSW 1 90794207 missense probably damaging 1.00
R6925:Col6a3 UTSW 1 90816002 missense probably benign 0.00
R6978:Col6a3 UTSW 1 90807470 critical splice donor site probably null
R7058:Col6a3 UTSW 1 90828037 nonsense probably null
X0024:Col6a3 UTSW 1 90803637 critical splice donor site probably null
X0063:Col6a3 UTSW 1 90803905 missense probably damaging 1.00
X0067:Col6a3 UTSW 1 90811529 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGATTGGCATGGATATAGCTCAAG -3'
(R):5'- TGCCACGTTGACTACCTCTG -3'

Sequencing Primer
(F):5'- AGAGCCTGCGTTCAAGC -3'
(R):5'- ACGTTGACTACCTCTGTGTTCTGAG -3'
Posted On2017-10-10