Incidental Mutation 'R6151:Etl4'
ID489224
Institutional Source Beutler Lab
Gene Symbol Etl4
Ensembl Gene ENSMUSG00000036617
Gene Nameenhancer trap locus 4
Synonyms6620402G01Rik, 9430077C05Rik, Skt, Sickle tail, E330027G05Rik, Etl-4
MMRRC Submission 044298-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.697) question?
Stock #R6151 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location19909780-20810713 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 20713360 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 304 (I304N)
Ref Sequence ENSEMBL: ENSMUSP00000110274 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045555] [ENSMUST00000066509] [ENSMUST00000114604] [ENSMUST00000114610] [ENSMUST00000114614] [ENSMUST00000114627]
Predicted Effect probably damaging
Transcript: ENSMUST00000045555
AA Change: I253N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041431
Gene: ENSMUSG00000036617
AA Change: I253N

DomainStartEndE-ValueType
Pfam:AIP3 188 291 1.7e-11 PFAM
low complexity region 313 328 N/A INTRINSIC
low complexity region 350 368 N/A INTRINSIC
coiled coil region 620 652 N/A INTRINSIC
low complexity region 1067 1096 N/A INTRINSIC
low complexity region 1212 1231 N/A INTRINSIC
low complexity region 1296 1314 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000066509
AA Change: I253N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066170
Gene: ENSMUSG00000036617
AA Change: I253N

DomainStartEndE-ValueType
low complexity region 313 328 N/A INTRINSIC
low complexity region 350 368 N/A INTRINSIC
coiled coil region 655 687 N/A INTRINSIC
low complexity region 1102 1131 N/A INTRINSIC
low complexity region 1372 1381 N/A INTRINSIC
low complexity region 1470 1495 N/A INTRINSIC
low complexity region 1571 1582 N/A INTRINSIC
coiled coil region 1658 1686 N/A INTRINSIC
low complexity region 1724 1737 N/A INTRINSIC
low complexity region 1806 1825 N/A INTRINSIC
low complexity region 1890 1908 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114604
AA Change: I253N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110251
Gene: ENSMUSG00000036617
AA Change: I253N

DomainStartEndE-ValueType
Pfam:AIP3 188 291 1.7e-11 PFAM
low complexity region 313 328 N/A INTRINSIC
low complexity region 350 368 N/A INTRINSIC
coiled coil region 655 687 N/A INTRINSIC
low complexity region 1102 1131 N/A INTRINSIC
low complexity region 1207 1226 N/A INTRINSIC
low complexity region 1291 1309 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114610
AA Change: I173N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110257
Gene: ENSMUSG00000036617
AA Change: I173N

DomainStartEndE-ValueType
Pfam:AIP3 108 211 5e-12 PFAM
low complexity region 233 248 N/A INTRINSIC
low complexity region 270 288 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114614
AA Change: I253N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110261
Gene: ENSMUSG00000036617
AA Change: I253N

DomainStartEndE-ValueType
Pfam:AIP3 188 291 1.7e-11 PFAM
low complexity region 313 328 N/A INTRINSIC
low complexity region 350 368 N/A INTRINSIC
coiled coil region 620 652 N/A INTRINSIC
low complexity region 1056 1085 N/A INTRINSIC
low complexity region 1201 1220 N/A INTRINSIC
low complexity region 1285 1303 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114627
AA Change: I304N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110274
Gene: ENSMUSG00000036617
AA Change: I304N

DomainStartEndE-ValueType
low complexity region 21 38 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
Pfam:AIP3 239 341 2.4e-14 PFAM
low complexity region 364 379 N/A INTRINSIC
low complexity region 401 419 N/A INTRINSIC
Pfam:AIP3 600 841 1.1e-12 PFAM
low complexity region 1153 1182 N/A INTRINSIC
low complexity region 1423 1432 N/A INTRINSIC
low complexity region 1521 1546 N/A INTRINSIC
low complexity region 1622 1633 N/A INTRINSIC
coiled coil region 1709 1737 N/A INTRINSIC
low complexity region 1775 1788 N/A INTRINSIC
low complexity region 1857 1876 N/A INTRINSIC
low complexity region 1941 1959 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125556
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129278
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136870
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137186
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146613
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene-trapped allele display malformations of the notochord and caudal vertebrae and may exhibit caudal tail kinks. Mice homozygous for another gene-trapped allele have malformed caudal vertebrae and intervertebral disk abnormalities; about half display kinked tails. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A T 13: 66,431,681 C248S probably damaging Het
3110009E18Rik A G 1: 120,171,486 probably null Het
4930550C14Rik G T 9: 53,414,383 R73S probably damaging Het
Abca1 A G 4: 53,085,261 V517A probably benign Het
Adck5 A T 15: 76,594,687 K370N possibly damaging Het
Akap6 A C 12: 53,025,792 D981A probably damaging Het
Apbb1 G A 7: 105,574,252 R51* probably null Het
Arhgap23 A G 11: 97,500,412 M1252V probably benign Het
Arhgef1 A G 7: 24,917,942 T354A probably benign Het
Arid1a G T 4: 133,684,976 Q1636K unknown Het
Asmt C T X: 170,676,467 A237V possibly damaging Het
Brat1 T A 5: 140,705,961 C43S probably benign Het
Cd36 T C 5: 17,795,595 Y370C probably damaging Het
Ceacam12 A T 7: 18,069,105 L145F probably benign Het
Col24a1 C T 3: 145,314,054 T62I probably damaging Het
Col6a3 G T 1: 90,813,753 N652K possibly damaging Het
Dcbld1 T C 10: 52,304,660 L140P probably damaging Het
Dhrs13 G A 11: 78,036,982 C218Y probably damaging Het
Diaph1 T G 18: 37,853,353 E1158A probably damaging Het
Emp2 A C 16: 10,292,281 F20C probably damaging Het
Enpep T C 3: 129,332,418 I22V possibly damaging Het
Epha2 A G 4: 141,318,480 probably null Het
Eprs G T 1: 185,407,754 probably null Het
Exoc3l2 C A 7: 19,491,745 S89* probably null Het
F5 A T 1: 164,181,635 I325F probably damaging Het
F5 G A 1: 164,190,187 C611Y probably damaging Het
Fam133b A T 5: 3,559,133 S116C probably null Het
Fam13b A T 18: 34,494,277 D190E probably damaging Het
Fam169a T G 13: 97,093,630 Y58D probably damaging Het
Far1 G A 7: 113,561,396 R383H possibly damaging Het
Fnbp1l T C 3: 122,570,930 K52R possibly damaging Het
Foxj3 C A 4: 119,623,271 Q469K unknown Het
Frs3 A T 17: 47,689,088 probably benign Het
Gdpd3 A G 7: 126,775,502 S290G probably benign Het
Gm6768 T G 12: 119,261,106 noncoding transcript Het
Gmip T A 8: 69,817,085 L610Q probably damaging Het
Gprc5c T A 11: 114,864,025 I176N probably damaging Het
Grm3 A G 5: 9,511,556 F765L probably damaging Het
Hhat A T 1: 192,759,757 L2Q probably damaging Het
Hrasls5 C T 19: 7,619,291 P148S probably damaging Het
Hspbap1 T C 16: 35,817,222 S214P probably damaging Het
Ighv1-62-3 C A 12: 115,461,289 V21F probably damaging Het
Kcnj15 A T 16: 95,295,668 K50* probably null Het
Kidins220 T C 12: 25,056,909 S1454P possibly damaging Het
Kl T A 5: 150,988,853 M689K possibly damaging Het
Klhl23 T G 2: 69,824,854 L356R probably damaging Het
Kndc1 A T 7: 139,921,213 D806V probably benign Het
Krt26 T C 11: 99,337,489 E139G probably benign Het
Lefty1 T C 1: 180,935,116 F3L unknown Het
Madd A C 2: 91,165,457 Y853* probably null Het
Map1a T A 2: 121,289,823 D63E probably benign Het
Mdn1 T A 4: 32,684,735 V815E probably damaging Het
Mettl3 A G 14: 52,295,020 Y569H probably damaging Het
Mknk2 T C 10: 80,669,025 probably null Het
Mpp3 C A 11: 102,008,566 R376S probably benign Het
Nup160 T A 2: 90,690,105 Y293* probably null Het
Nupl1 A T 14: 60,244,616 F100I possibly damaging Het
Nxpe2 A C 9: 48,326,191 L255V probably benign Het
Olfr1423 T C 19: 12,036,736 E2G probably benign Het
Olfr167 A T 16: 19,515,531 L35Q probably damaging Het
Olfr390 T A 11: 73,787,695 Y252* probably null Het
Olfr479 A G 7: 108,055,899 I306V probably benign Het
Padi3 A T 4: 140,796,394 D248E probably damaging Het
Paxip1 G T 5: 27,761,618 H637N probably damaging Het
Pde4b T A 4: 102,601,551 M296K probably damaging Het
Pkd1 A G 17: 24,575,606 H2089R probably benign Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Rhebl1 T C 15: 98,878,279 I165V probably benign Het
Rock1 A T 18: 10,106,426 V481E possibly damaging Het
Rtca T A 3: 116,507,827 T24S probably benign Het
Serpina3c T A 12: 104,152,068 I4F possibly damaging Het
Serpina3j C A 12: 104,317,390 A249E possibly damaging Het
Slc38a9 A G 13: 112,689,376 N116S probably damaging Het
Slco2b1 C T 7: 99,690,563 V58I possibly damaging Het
Slfn8 T A 11: 83,017,321 Y132F probably damaging Het
Smg6 T G 11: 75,156,207 I1242S probably damaging Het
Tap2 G T 17: 34,212,047 V374L probably benign Het
Tbc1d10b G A 7: 127,207,996 T123M probably damaging Het
Tenm2 A C 11: 36,008,783 V2516G probably damaging Het
Tenm3 C T 8: 48,395,573 R12Q probably damaging Het
Tmem130 T A 5: 144,737,851 M355L probably benign Het
Tns4 C T 11: 99,075,550 S433N probably benign Het
Traip G T 9: 107,970,619 probably null Het
Trmo G A 4: 46,389,390 R2C probably damaging Het
Ttn A T 2: 76,944,160 I2134N probably damaging Het
Uba1y A G Y: 825,984 D380G probably benign Het
Ube2t T A 1: 134,967,960 probably null Het
Ugdh A T 5: 65,417,581 Y367* probably null Het
Usp45 A C 4: 21,810,797 D331A probably damaging Het
Vmn1r84 G T 7: 12,361,914 T284K possibly damaging Het
Vmn1r91 T A 7: 20,101,435 F93Y probably benign Het
Vmn2r77 T A 7: 86,801,670 Y255N probably benign Het
Vmn2r96 A T 17: 18,583,959 Q490H probably benign Het
Vwa2 A G 19: 56,903,465 probably null Het
Vwf A G 6: 125,657,065 K169E unknown Het
Zc3h7b G C 15: 81,778,710 probably null Het
Zfp458 T A 13: 67,257,598 H259L possibly damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zfp804b A G 5: 6,769,910 V1051A probably benign Het
Other mutations in Etl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00907:Etl4 APN 2 20766478 missense possibly damaging 0.81
IGL00944:Etl4 APN 2 20530054 missense possibly damaging 0.52
IGL01078:Etl4 APN 2 20806531 nonsense probably null
IGL01099:Etl4 APN 2 20807111 missense probably benign 0.06
IGL01337:Etl4 APN 2 20785387 missense probably benign 0.01
IGL01348:Etl4 APN 2 20806973 missense probably damaging 1.00
IGL01349:Etl4 APN 2 20713396 missense probably damaging 1.00
IGL01407:Etl4 APN 2 20743856 missense probably damaging 0.99
IGL01552:Etl4 APN 2 20778189 missense probably damaging 0.99
IGL01662:Etl4 APN 2 20806649 missense probably benign 0.04
IGL01687:Etl4 APN 2 20530087 missense probably damaging 1.00
IGL01793:Etl4 APN 2 20743898 missense possibly damaging 0.87
IGL01844:Etl4 APN 2 20806682 missense probably benign 0.06
IGL02025:Etl4 APN 2 20806526 missense probably damaging 1.00
IGL02088:Etl4 APN 2 20806548 missense probably damaging 1.00
IGL02134:Etl4 APN 2 20806429 missense possibly damaging 0.79
IGL02369:Etl4 APN 2 20530189 missense probably damaging 1.00
IGL02480:Etl4 APN 2 20788524 missense probably damaging 0.99
IGL02560:Etl4 APN 2 20743718 missense probably damaging 1.00
IGL02851:Etl4 APN 2 20808029 missense possibly damaging 0.46
IGL02893:Etl4 APN 2 20760210 splice site probably benign
IGL02951:Etl4 APN 2 20801537 splice site probably benign
IGL03119:Etl4 APN 2 20713387 missense probably damaging 1.00
IGL03267:Etl4 APN 2 20785182 nonsense probably null
IGL03379:Etl4 APN 2 20662016 missense possibly damaging 0.87
R0038:Etl4 UTSW 2 20743574 missense probably damaging 1.00
R0038:Etl4 UTSW 2 20743574 missense probably damaging 1.00
R0095:Etl4 UTSW 2 20743868 missense probably damaging 1.00
R0100:Etl4 UTSW 2 20339905 missense probably benign
R0311:Etl4 UTSW 2 20807129 missense probably damaging 1.00
R0346:Etl4 UTSW 2 20759652 critical splice donor site probably null
R0348:Etl4 UTSW 2 20778129 missense probably damaging 1.00
R0379:Etl4 UTSW 2 20807354 missense probably damaging 0.98
R0571:Etl4 UTSW 2 20743769 missense probably damaging 0.99
R0697:Etl4 UTSW 2 20743861 missense probably damaging 1.00
R0707:Etl4 UTSW 2 20805571 splice site probably benign
R0980:Etl4 UTSW 2 20801567 missense probably damaging 1.00
R1120:Etl4 UTSW 2 20806703 missense probably benign 0.00
R1254:Etl4 UTSW 2 20807923 missense probably damaging 1.00
R1346:Etl4 UTSW 2 20806144 missense possibly damaging 0.94
R1460:Etl4 UTSW 2 20788477 missense probably damaging 1.00
R1503:Etl4 UTSW 2 20743874 missense possibly damaging 0.94
R1547:Etl4 UTSW 2 20785228 missense probably damaging 1.00
R1627:Etl4 UTSW 2 20801579 missense possibly damaging 0.91
R1635:Etl4 UTSW 2 20806408 missense probably damaging 1.00
R1716:Etl4 UTSW 2 20743681 missense probably damaging 1.00
R1795:Etl4 UTSW 2 20808026 critical splice donor site probably null
R1885:Etl4 UTSW 2 20743984 missense probably damaging 1.00
R2039:Etl4 UTSW 2 20785228 missense probably damaging 1.00
R2083:Etl4 UTSW 2 20743549 missense probably damaging 1.00
R2109:Etl4 UTSW 2 20785342 missense probably benign 0.27
R2153:Etl4 UTSW 2 20798734 missense probably benign 0.00
R2403:Etl4 UTSW 2 20807306 nonsense probably null
R2883:Etl4 UTSW 2 20806174 missense possibly damaging 0.83
R2985:Etl4 UTSW 2 20781849 missense probably damaging 1.00
R3402:Etl4 UTSW 2 20781882 missense probably damaging 1.00
R3696:Etl4 UTSW 2 20801662 critical splice donor site probably null
R3755:Etl4 UTSW 2 20743537 missense probably benign 0.10
R3813:Etl4 UTSW 2 20788435 missense probably damaging 1.00
R3829:Etl4 UTSW 2 20785421 missense probably benign 0.07
R3887:Etl4 UTSW 2 20529961 nonsense probably null
R3888:Etl4 UTSW 2 20529961 nonsense probably null
R3889:Etl4 UTSW 2 20529961 nonsense probably null
R3958:Etl4 UTSW 2 20340043 missense probably benign
R3959:Etl4 UTSW 2 20340043 missense probably benign
R3960:Etl4 UTSW 2 20340043 missense probably benign
R4058:Etl4 UTSW 2 20806019 missense possibly damaging 0.59
R4074:Etl4 UTSW 2 20809219 utr 3 prime probably benign
R4077:Etl4 UTSW 2 20807961 missense probably damaging 1.00
R4078:Etl4 UTSW 2 20807961 missense probably damaging 1.00
R4127:Etl4 UTSW 2 20744075 missense possibly damaging 0.93
R4200:Etl4 UTSW 2 20781883 missense probably damaging 1.00
R4492:Etl4 UTSW 2 20806865 missense possibly damaging 0.67
R4514:Etl4 UTSW 2 20661898 missense probably damaging 1.00
R4820:Etl4 UTSW 2 20806685 missense possibly damaging 0.85
R4825:Etl4 UTSW 2 20806927 missense probably damaging 1.00
R4888:Etl4 UTSW 2 20340111 critical splice donor site probably null
R4938:Etl4 UTSW 2 20798649 missense probably benign 0.00
R4943:Etl4 UTSW 2 20807281 missense probably benign 0.05
R5121:Etl4 UTSW 2 20340111 critical splice donor site probably null
R5191:Etl4 UTSW 2 20339999 missense probably damaging 0.99
R5198:Etl4 UTSW 2 20713387 missense probably damaging 1.00
R5199:Etl4 UTSW 2 20744042 missense probably damaging 1.00
R5470:Etl4 UTSW 2 20529980 missense probably damaging 0.99
R5513:Etl4 UTSW 2 20743827 missense probably damaging 1.00
R5620:Etl4 UTSW 2 20530226 missense probably damaging 1.00
R5635:Etl4 UTSW 2 20807035 missense probably damaging 1.00
R5641:Etl4 UTSW 2 20806462 frame shift probably null
R5690:Etl4 UTSW 2 20805836 missense probably benign 0.01
R5784:Etl4 UTSW 2 20806205 missense possibly damaging 0.79
R5794:Etl4 UTSW 2 20806512 missense probably damaging 1.00
R5908:Etl4 UTSW 2 20743907 missense probably damaging 0.96
R5982:Etl4 UTSW 2 20781015 missense probably damaging 1.00
R6192:Etl4 UTSW 2 20801551 missense probably damaging 0.98
R6238:Etl4 UTSW 2 20801568 missense probably damaging 1.00
R6248:Etl4 UTSW 2 20809089 missense possibly damaging 0.90
R6292:Etl4 UTSW 2 20743573 missense probably damaging 1.00
R6610:Etl4 UTSW 2 20713369 missense probably damaging 1.00
R6739:Etl4 UTSW 2 20713435 missense probably damaging 1.00
R6846:Etl4 UTSW 2 20744108 missense possibly damaging 0.94
R6863:Etl4 UTSW 2 20806309 missense probably benign 0.01
R6873:Etl4 UTSW 2 20797992 synonymous probably null
R7003:Etl4 UTSW 2 20805884 missense probably benign 0.03
R7155:Etl4 UTSW 2 20806931 missense probably damaging 0.96
R7207:Etl4 UTSW 2 20709576 missense probably damaging 0.99
R7230:Etl4 UTSW 2 20797988 missense probably damaging 1.00
R7305:Etl4 UTSW 2 20709557 missense probably damaging 1.00
X0018:Etl4 UTSW 2 20809190 missense probably damaging 0.98
X0022:Etl4 UTSW 2 20709564 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAGAATAACATGTTCGCTAGG -3'
(R):5'- ATGAGCAGCATGAACCTGGG -3'

Sequencing Primer
(F):5'- TTCGCTAGGAACAAGTGAAGG -3'
(R):5'- GAACCATGGTCGTCAGGTATG -3'
Posted On2017-10-10