Incidental Mutation 'R6152:Mcm2'
ID 489332
Institutional Source Beutler Lab
Gene Symbol Mcm2
Ensembl Gene ENSMUSG00000002870
Gene Name minichromosome maintenance complex component 2
Synonyms BM28, CDCL1, Mcmd2
MMRRC Submission 044299-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6152 (G1)
Quality Score 217.468
Status Not validated
Chromosome 6
Chromosomal Location 88860456-88875762 bp(-) (GRCm39)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) TTCTGATAGATGGTCTG to TTCTG at 88866891 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145295 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058011] [ENSMUST00000205165]
AlphaFold P97310
Predicted Effect probably benign
Transcript: ENSMUST00000058011
SMART Domains Protein: ENSMUSP00000061923
Gene: ENSMUSG00000002870

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:MCM2_N 50 182 3.5e-20 PFAM
MCM 290 803 N/A SMART
Blast:MCM 816 891 3e-38 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203172
Predicted Effect probably benign
Transcript: ENSMUST00000203935
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204393
Predicted Effect probably benign
Transcript: ENSMUST00000205165
SMART Domains Protein: ENSMUSP00000145295
Gene: ENSMUSG00000002870

DomainStartEndE-ValueType
low complexity region 11 32 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are involved in the initiation of eukaryotic genome replication. The hexameric protein complex formed by MCM proteins is a key component of the pre-replication complex (pre_RC) and may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. This protein forms a complex with MCM4, 6, and 7, and has been shown to regulate the helicase activity of the complex. This protein is phosphorylated, and thus regulated by, protein kinases CDC2 and CDC7. Multiple alternatively spliced transcript variants have been found, but the full-length nature of some variants has not been defined. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for non functional alleles at this locus die prematurely. There is an increased tumor incidence and abnormalities in a variety of systems in mice as they become moribund. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A G 11: 110,204,187 (GRCm39) C363R probably damaging Het
Afg3l2 G T 18: 67,554,329 (GRCm39) L458M probably damaging Het
Anln A C 9: 22,271,803 (GRCm39) I684R probably damaging Het
Atoh7 A T 10: 62,936,278 (GRCm39) D115V probably damaging Het
Atp11a T A 8: 12,896,100 (GRCm39) I223K probably damaging Het
Cabs1 C T 5: 88,127,613 (GRCm39) T88I possibly damaging Het
Cblb T A 16: 51,961,419 (GRCm39) C345S probably damaging Het
Cep250 A G 2: 155,823,358 (GRCm39) E1003G possibly damaging Het
Chpf C T 1: 75,452,287 (GRCm39) R389H possibly damaging Het
Cntnap5c A G 17: 58,593,881 (GRCm39) D740G possibly damaging Het
Col19a1 T C 1: 24,413,702 (GRCm39) T411A unknown Het
Dgat2 T C 7: 98,813,885 (GRCm39) N99S probably benign Het
Fbxo7 A T 10: 85,860,560 (GRCm39) T56S probably benign Het
Gm15130 T A 2: 110,974,950 (GRCm39) Q71L unknown Het
Gpr161 T A 1: 165,137,864 (GRCm39) V150E possibly damaging Het
Hmcn1 T C 1: 150,441,176 (GRCm39) E5360G probably damaging Het
Hmg20a A G 9: 56,388,892 (GRCm39) D153G probably damaging Het
Hrct1 T A 4: 43,727,498 (GRCm39) V46D possibly damaging Het
Idh1 T C 1: 65,198,689 (GRCm39) T394A probably damaging Het
Kazn A G 4: 141,836,598 (GRCm39) I547T unknown Het
Klhdc3 A T 17: 46,988,633 (GRCm39) I142N probably damaging Het
Lrrc39 G T 3: 116,364,624 (GRCm39) probably null Het
Mamdc4 T C 2: 25,457,451 (GRCm39) D510G probably damaging Het
Ndfip2 A G 14: 105,535,538 (GRCm39) I275V possibly damaging Het
Or1i2 T C 10: 78,448,409 (GRCm39) D22G probably benign Het
Or5b24 A T 19: 12,912,851 (GRCm39) I250L probably benign Het
Pacsin2 A C 15: 83,261,900 (GRCm39) D154E probably damaging Het
Pcdhb5 T A 18: 37,455,886 (GRCm39) C755* probably null Het
Pcnx2 T C 8: 126,480,491 (GRCm39) S1939G probably damaging Het
Pfkl A T 10: 77,825,985 (GRCm39) H602Q probably benign Het
Pon3 G A 6: 5,221,716 (GRCm39) R305C probably damaging Het
Prpf6 A G 2: 181,263,580 (GRCm39) R147G probably damaging Het
Sh3yl1 A G 12: 30,992,034 (GRCm39) E201G probably benign Het
Slc25a36 A G 9: 96,982,210 (GRCm39) Y22H probably damaging Het
Sult6b2 A C 6: 142,750,102 (GRCm39) S5R probably benign Het
Susd2 C T 10: 75,473,853 (GRCm39) A581T probably damaging Het
Tysnd1 A G 10: 61,532,113 (GRCm39) D255G probably damaging Het
Zbtb6 A C 2: 37,319,255 (GRCm39) I224M probably benign Het
Zdhhc8 G T 16: 18,041,202 (GRCm39) N719K possibly damaging Het
Zkscan16 A G 4: 58,946,260 (GRCm39) E45G possibly damaging Het
Other mutations in Mcm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Mcm2 APN 6 88,870,383 (GRCm39) missense probably benign 0.04
IGL01082:Mcm2 APN 6 88,864,859 (GRCm39) missense probably benign 0.05
IGL01451:Mcm2 APN 6 88,868,948 (GRCm39) splice site probably benign
IGL01534:Mcm2 APN 6 88,864,700 (GRCm39) critical splice donor site probably null
IGL01670:Mcm2 APN 6 88,864,614 (GRCm39) unclassified probably benign
IGL01724:Mcm2 APN 6 88,863,044 (GRCm39) missense probably damaging 1.00
IGL01936:Mcm2 APN 6 88,868,708 (GRCm39) missense probably damaging 1.00
IGL02082:Mcm2 APN 6 88,865,218 (GRCm39) nonsense probably null
dander UTSW 6 88,864,786 (GRCm39) missense possibly damaging 0.53
spores UTSW 6 88,874,432 (GRCm39) missense probably benign
R0254:Mcm2 UTSW 6 88,860,998 (GRCm39) missense probably damaging 0.99
R1673:Mcm2 UTSW 6 88,869,060 (GRCm39) missense probably benign 0.12
R1740:Mcm2 UTSW 6 88,861,026 (GRCm39) missense probably damaging 1.00
R1761:Mcm2 UTSW 6 88,866,770 (GRCm39) missense possibly damaging 0.90
R1917:Mcm2 UTSW 6 88,868,785 (GRCm39) missense possibly damaging 0.88
R2250:Mcm2 UTSW 6 88,869,990 (GRCm39) missense probably damaging 0.99
R2307:Mcm2 UTSW 6 88,869,990 (GRCm39) missense probably damaging 0.99
R2308:Mcm2 UTSW 6 88,869,990 (GRCm39) missense probably damaging 0.99
R2309:Mcm2 UTSW 6 88,869,990 (GRCm39) missense probably damaging 0.99
R2379:Mcm2 UTSW 6 88,869,990 (GRCm39) missense probably damaging 0.99
R3431:Mcm2 UTSW 6 88,869,990 (GRCm39) missense probably damaging 0.99
R3432:Mcm2 UTSW 6 88,869,990 (GRCm39) missense probably damaging 0.99
R3878:Mcm2 UTSW 6 88,869,990 (GRCm39) missense probably damaging 0.99
R3911:Mcm2 UTSW 6 88,865,234 (GRCm39) missense probably damaging 0.98
R3934:Mcm2 UTSW 6 88,869,990 (GRCm39) missense probably damaging 0.99
R3936:Mcm2 UTSW 6 88,869,990 (GRCm39) missense probably damaging 0.99
R4640:Mcm2 UTSW 6 88,864,786 (GRCm39) missense possibly damaging 0.53
R4749:Mcm2 UTSW 6 88,868,973 (GRCm39) missense possibly damaging 0.95
R5267:Mcm2 UTSW 6 88,874,432 (GRCm39) missense probably benign
R5701:Mcm2 UTSW 6 88,870,073 (GRCm39) missense probably damaging 1.00
R5872:Mcm2 UTSW 6 88,861,053 (GRCm39) missense probably benign 0.05
R6118:Mcm2 UTSW 6 88,864,818 (GRCm39) missense probably damaging 1.00
R6207:Mcm2 UTSW 6 88,862,844 (GRCm39) missense probably benign 0.00
R6550:Mcm2 UTSW 6 88,863,941 (GRCm39) critical splice donor site probably null
R7184:Mcm2 UTSW 6 88,868,776 (GRCm39) missense probably damaging 1.00
R7303:Mcm2 UTSW 6 88,864,928 (GRCm39) missense probably damaging 1.00
R8069:Mcm2 UTSW 6 88,869,039 (GRCm39) missense probably damaging 1.00
R8215:Mcm2 UTSW 6 88,874,293 (GRCm39) missense probably damaging 0.98
R9121:Mcm2 UTSW 6 88,861,019 (GRCm39) missense probably benign
R9745:Mcm2 UTSW 6 88,868,729 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTTCTGACTCAAGAGCTGGTGC -3'
(R):5'- ACACTGTCTAGGGATCGTGG -3'

Sequencing Primer
(F):5'- AGGCTGAACGCACCCATG -3'
(R):5'- ATCGTGGCAGGTGAAGAGACTTTC -3'
Posted On 2017-10-10