Incidental Mutation 'R6153:Snx14'
ID489397
Institutional Source Beutler Lab
Gene Symbol Snx14
Ensembl Gene ENSMUSG00000032422
Gene Namesorting nexin 14
SynonymsC330035N22Rik, YR-14
MMRRC Submission 044300-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6153 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location88376750-88438958 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88391806 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 644 (Y644C)
Ref Sequence ENSEMBL: ENSMUSP00000133533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000126405] [ENSMUST00000165315] [ENSMUST00000173011] [ENSMUST00000173039] [ENSMUST00000174806]
Predicted Effect probably benign
Transcript: ENSMUST00000126405
SMART Domains Protein: ENSMUSP00000116773
Gene: ENSMUSG00000032422

DomainStartEndE-ValueType
transmembrane domain 57 76 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
Pfam:PXA 157 210 3.9e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140439
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155008
Predicted Effect probably damaging
Transcript: ENSMUST00000165315
AA Change: Y635C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130116
Gene: ENSMUSG00000032422
AA Change: Y635C

DomainStartEndE-ValueType
transmembrane domain 54 73 N/A INTRINSIC
transmembrane domain 75 97 N/A INTRINSIC
Pfam:PXA 157 330 8.2e-49 PFAM
Pfam:RGS 363 495 4.3e-13 PFAM
PX 585 704 8.77e-13 SMART
low complexity region 771 785 N/A INTRINSIC
Pfam:Nexin_C 825 930 2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173011
SMART Domains Protein: ENSMUSP00000133507
Gene: ENSMUSG00000032422

DomainStartEndE-ValueType
transmembrane domain 54 73 N/A INTRINSIC
transmembrane domain 75 97 N/A INTRINSIC
Pfam:PXA 157 330 3.1e-49 PFAM
Pfam:RGS 363 482 3.1e-9 PFAM
low complexity region 499 513 N/A INTRINSIC
Pfam:Nexin_C 553 658 7.2e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000173039
AA Change: Y591C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133624
Gene: ENSMUSG00000032422
AA Change: Y591C

DomainStartEndE-ValueType
transmembrane domain 54 73 N/A INTRINSIC
transmembrane domain 75 97 N/A INTRINSIC
Pfam:PXA 154 286 6.5e-33 PFAM
Pfam:RGS 319 451 2.6e-13 PFAM
PX 541 660 8.77e-13 SMART
low complexity region 727 741 N/A INTRINSIC
Pfam:Nexin_C 781 886 1.1e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000174806
AA Change: Y644C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133533
Gene: ENSMUSG00000032422
AA Change: Y644C

DomainStartEndE-ValueType
transmembrane domain 54 73 N/A INTRINSIC
transmembrane domain 75 97 N/A INTRINSIC
Pfam:PXA 158 327 1.9e-44 PFAM
Pfam:RGS 363 495 1.3e-13 PFAM
PX 594 713 8.77e-13 SMART
low complexity region 780 794 N/A INTRINSIC
Pfam:Nexin_C 834 938 2.8e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187610
Meta Mutation Damage Score 0.368 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.3%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family have a phox (PX) phosphoinositide binding domain and are involved in intracellular trafficking. The encoded protein also contains a regulator of G protein signaling (RGS) domain. Regulator of G protein signaling family members are regulatory molecules that act as GTPase activating proteins for G alpha subunits of heterotrimeric G proteins. Alternate splicing results in transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G T 11: 9,301,259 probably null Het
Ache T C 5: 137,291,855 I394T probably damaging Het
Acsm1 G A 7: 119,633,066 G62D probably damaging Het
Actrt3 T A 3: 30,599,750 I34F probably damaging Het
Adgrf5 T C 17: 43,451,083 I1223T possibly damaging Het
Adora2a T C 10: 75,326,147 F40S possibly damaging Het
Ano8 T C 8: 71,480,797 probably benign Het
Arid1b T A 17: 5,242,832 L675Q probably damaging Het
Atg2b T C 12: 105,623,482 I1837V possibly damaging Het
Atp10b A G 11: 43,254,282 Y1284C probably damaging Het
B3gnt7 G T 1: 86,305,515 G44V probably damaging Het
Chrna1 G T 2: 73,573,309 H99N probably benign Het
Cnksr1 T C 4: 134,233,893 H220R probably damaging Het
Cpsf2 T A 12: 101,999,360 probably null Het
D3Ertd254e A G 3: 36,165,154 H442R possibly damaging Het
Daglb T C 5: 143,503,341 L651P probably benign Het
Ddx60 A G 8: 61,945,940 D231G possibly damaging Het
Ehd4 A C 2: 120,102,423 F174C probably damaging Het
Emsy G T 7: 98,610,853 P9T probably damaging Het
Fnbp1l T C 3: 122,559,156 E217G probably benign Het
Gm11596 A T 11: 99,792,698 C199S unknown Het
Gmps T G 3: 64,001,543 C489G probably benign Het
Gpsm1 T C 2: 26,325,413 Y296H probably benign Het
Heatr5b T C 17: 78,831,441 T91A possibly damaging Het
Hs3st3b1 A T 11: 63,889,498 W268R probably damaging Het
Il27ra T C 8: 84,032,144 probably null Het
Itga5 T A 15: 103,357,453 I156F probably damaging Het
Kcnmb3 T A 3: 32,473,827 D96V probably damaging Het
Khdrbs1 T A 4: 129,716,172 N417Y probably damaging Het
Loxhd1 A G 18: 77,295,758 N118D possibly damaging Het
Mdm4 A G 1: 132,992,107 L341P probably damaging Het
Mecom T C 3: 29,993,648 E225G possibly damaging Het
Megf8 G A 7: 25,347,371 G1560S possibly damaging Het
Mfsd13a A T 19: 46,367,882 D142V probably damaging Het
Muc5b A T 7: 141,861,444 Y2709F possibly damaging Het
Nelfa A T 5: 33,898,879 I480N probably damaging Het
Olfr1329 G A 4: 118,916,747 S240F probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Palld G T 8: 61,550,152 N304K probably damaging Het
Pcsk5 A G 19: 17,511,492 L988P probably damaging Het
Prmt1 A T 7: 44,981,827 F34I probably damaging Het
Pzp A G 6: 128,489,016 S1234P probably benign Het
Ralb A T 1: 119,478,140 probably null Het
Robo2 T A 16: 73,920,729 D141V probably damaging Het
Rsrc1 T C 3: 67,355,562 I283T probably benign Het
Sec62 A T 3: 30,810,482 K165M unknown Het
Sez6 A G 11: 77,977,822 D974G probably damaging Het
Shc2 T A 10: 79,629,918 I187F possibly damaging Het
Shroom3 G A 5: 92,964,408 R1876Q probably damaging Het
Siglecg C A 7: 43,412,017 N481K possibly damaging Het
Skil T A 3: 31,097,853 F175I probably damaging Het
Slc1a1 T C 19: 28,909,535 V432A probably damaging Het
Slit3 G T 11: 35,700,483 G1374V possibly damaging Het
Snx33 T A 9: 56,926,699 I29F possibly damaging Het
Sos1 T A 17: 80,449,335 I263L probably benign Het
Susd2 C T 10: 75,638,019 A581T probably damaging Het
Tbpl2 C A 2: 24,076,016 V320F probably damaging Het
Tmem209 A G 6: 30,505,795 S171P probably benign Het
Tprkb T A 6: 85,916,190 probably null Het
Tspan11 G A 6: 127,939,098 S119N probably benign Het
Ulk2 A T 11: 61,781,746 V922D probably damaging Het
Zfp976 A C 7: 42,614,186 Y76D probably damaging Het
Zkscan2 G A 7: 123,489,770 T426I probably benign Het
Other mutations in Snx14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00487:Snx14 APN 9 88402190 missense probably damaging 0.99
IGL00773:Snx14 APN 9 88394539 missense probably damaging 0.96
IGL00847:Snx14 APN 9 88420329 missense probably damaging 1.00
IGL01526:Snx14 APN 9 88381500 missense probably damaging 0.99
IGL01662:Snx14 APN 9 88385838 splice site probably benign
IGL01928:Snx14 APN 9 88381512 missense probably benign 0.04
IGL02225:Snx14 APN 9 88413524 missense probably damaging 0.99
IGL02498:Snx14 APN 9 88407464 missense probably damaging 1.00
IGL02585:Snx14 APN 9 88404518 missense possibly damaging 0.92
IGL02634:Snx14 APN 9 88403303 missense probably damaging 1.00
IGL03073:Snx14 APN 9 88422896 critical splice donor site probably null
R0167:Snx14 UTSW 9 88407416 missense probably damaging 1.00
R0324:Snx14 UTSW 9 88405238 critical splice donor site probably null
R0627:Snx14 UTSW 9 88394430 missense probably benign
R0862:Snx14 UTSW 9 88383996 missense possibly damaging 0.81
R0864:Snx14 UTSW 9 88383996 missense possibly damaging 0.81
R0973:Snx14 UTSW 9 88400721 critical splice donor site probably null
R0973:Snx14 UTSW 9 88400721 critical splice donor site probably null
R0974:Snx14 UTSW 9 88400721 critical splice donor site probably null
R1478:Snx14 UTSW 9 88394528 missense probably benign 0.00
R1511:Snx14 UTSW 9 88398364 nonsense probably null
R1522:Snx14 UTSW 9 88402224 missense possibly damaging 0.52
R1612:Snx14 UTSW 9 88376905 missense possibly damaging 0.81
R1634:Snx14 UTSW 9 88385739 missense probably benign 0.00
R1634:Snx14 UTSW 9 88407490 splice site probably benign
R1704:Snx14 UTSW 9 88413538 missense probably damaging 1.00
R1713:Snx14 UTSW 9 88415675 missense probably damaging 1.00
R1883:Snx14 UTSW 9 88402261 missense probably benign 0.01
R3701:Snx14 UTSW 9 88420243 splice site probably benign
R3853:Snx14 UTSW 9 88407319 splice site probably benign
R4301:Snx14 UTSW 9 88410623 missense probably damaging 1.00
R4449:Snx14 UTSW 9 88422999 missense probably benign 0.05
R4793:Snx14 UTSW 9 88394442 missense probably damaging 0.98
R4934:Snx14 UTSW 9 88398288 missense probably damaging 0.98
R5126:Snx14 UTSW 9 88382099 missense probably damaging 1.00
R5227:Snx14 UTSW 9 88398294 missense possibly damaging 0.77
R5518:Snx14 UTSW 9 88383802 missense probably damaging 1.00
R5838:Snx14 UTSW 9 88391776 missense probably damaging 1.00
R5957:Snx14 UTSW 9 88403274 missense possibly damaging 0.84
R6156:Snx14 UTSW 9 88407339 missense possibly damaging 0.92
R6703:Snx14 UTSW 9 88422914 missense probably damaging 0.96
R6784:Snx14 UTSW 9 88381792 missense probably benign 0.01
R6823:Snx14 UTSW 9 88394382 missense possibly damaging 0.90
R6837:Snx14 UTSW 9 88380223 missense probably benign 0.07
R7169:Snx14 UTSW 9 88398309 missense probably damaging 0.98
R7216:Snx14 UTSW 9 88381791 missense probably damaging 0.99
R7224:Snx14 UTSW 9 88394561 missense possibly damaging 0.92
R7357:Snx14 UTSW 9 88404316 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- TGTACAAACAGCTGCCTTTAAACAC -3'
(R):5'- GGAAATCCACCTGTTTGTTTGACAAC -3'

Sequencing Primer
(F):5'- ACAGCTGCCTTTAAACACTTATC -3'
(R):5'- TGTAATGTAATACCCCCATTT -3'
Posted On2017-10-10