Incidental Mutation 'R6153:Atp10b'
ID489403
Institutional Source Beutler Lab
Gene Symbol Atp10b
Ensembl Gene ENSMUSG00000055415
Gene NameATPase, class V, type 10B
Synonyms5930426O13Rik, 9030605H24Rik
MMRRC Submission 044300-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R6153 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location43149877-43262285 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43254282 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 1284 (Y1284C)
Ref Sequence ENSEMBL: ENSMUSP00000076844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077659]
Predicted Effect probably damaging
Transcript: ENSMUST00000077659
AA Change: Y1284C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076844
Gene: ENSMUSG00000055415
AA Change: Y1284C

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 47 118 3.8e-26 PFAM
Pfam:E1-E2_ATPase 123 393 2.9e-7 PFAM
low complexity region 621 638 N/A INTRINSIC
Pfam:Cation_ATPase 692 799 7.1e-9 PFAM
Pfam:HAD 705 1062 6.7e-12 PFAM
Pfam:PhoLip_ATPase_C 1079 1324 1.9e-79 PFAM
low complexity region 1353 1366 N/A INTRINSIC
low complexity region 1457 1471 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127604
Meta Mutation Damage Score 0.298 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.3%
Validation Efficiency 99% (66/67)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G T 11: 9,301,259 probably null Het
Ache T C 5: 137,291,855 I394T probably damaging Het
Acsm1 G A 7: 119,633,066 G62D probably damaging Het
Actrt3 T A 3: 30,599,750 I34F probably damaging Het
Adgrf5 T C 17: 43,451,083 I1223T possibly damaging Het
Adora2a T C 10: 75,326,147 F40S possibly damaging Het
Ano8 T C 8: 71,480,797 probably benign Het
Arid1b T A 17: 5,242,832 L675Q probably damaging Het
Atg2b T C 12: 105,623,482 I1837V possibly damaging Het
B3gnt7 G T 1: 86,305,515 G44V probably damaging Het
Chrna1 G T 2: 73,573,309 H99N probably benign Het
Cnksr1 T C 4: 134,233,893 H220R probably damaging Het
Cpsf2 T A 12: 101,999,360 probably null Het
D3Ertd254e A G 3: 36,165,154 H442R possibly damaging Het
Daglb T C 5: 143,503,341 L651P probably benign Het
Ddx60 A G 8: 61,945,940 D231G possibly damaging Het
Ehd4 A C 2: 120,102,423 F174C probably damaging Het
Emsy G T 7: 98,610,853 P9T probably damaging Het
Fnbp1l T C 3: 122,559,156 E217G probably benign Het
Gm11596 A T 11: 99,792,698 C199S unknown Het
Gmps T G 3: 64,001,543 C489G probably benign Het
Gpsm1 T C 2: 26,325,413 Y296H probably benign Het
Heatr5b T C 17: 78,831,441 T91A possibly damaging Het
Hs3st3b1 A T 11: 63,889,498 W268R probably damaging Het
Il27ra T C 8: 84,032,144 probably null Het
Itga5 T A 15: 103,357,453 I156F probably damaging Het
Kcnmb3 T A 3: 32,473,827 D96V probably damaging Het
Khdrbs1 T A 4: 129,716,172 N417Y probably damaging Het
Loxhd1 A G 18: 77,295,758 N118D possibly damaging Het
Mdm4 A G 1: 132,992,107 L341P probably damaging Het
Mecom T C 3: 29,993,648 E225G possibly damaging Het
Megf8 G A 7: 25,347,371 G1560S possibly damaging Het
Mfsd13a A T 19: 46,367,882 D142V probably damaging Het
Muc5b A T 7: 141,861,444 Y2709F possibly damaging Het
Nelfa A T 5: 33,898,879 I480N probably damaging Het
Olfr1329 G A 4: 118,916,747 S240F probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Palld G T 8: 61,550,152 N304K probably damaging Het
Pcsk5 A G 19: 17,511,492 L988P probably damaging Het
Prmt1 A T 7: 44,981,827 F34I probably damaging Het
Pzp A G 6: 128,489,016 S1234P probably benign Het
Ralb A T 1: 119,478,140 probably null Het
Robo2 T A 16: 73,920,729 D141V probably damaging Het
Rsrc1 T C 3: 67,355,562 I283T probably benign Het
Sec62 A T 3: 30,810,482 K165M unknown Het
Sez6 A G 11: 77,977,822 D974G probably damaging Het
Shc2 T A 10: 79,629,918 I187F possibly damaging Het
Shroom3 G A 5: 92,964,408 R1876Q probably damaging Het
Siglecg C A 7: 43,412,017 N481K possibly damaging Het
Skil T A 3: 31,097,853 F175I probably damaging Het
Slc1a1 T C 19: 28,909,535 V432A probably damaging Het
Slit3 G T 11: 35,700,483 G1374V possibly damaging Het
Snx14 T C 9: 88,391,806 Y644C probably damaging Het
Snx33 T A 9: 56,926,699 I29F possibly damaging Het
Sos1 T A 17: 80,449,335 I263L probably benign Het
Susd2 C T 10: 75,638,019 A581T probably damaging Het
Tbpl2 C A 2: 24,076,016 V320F probably damaging Het
Tmem209 A G 6: 30,505,795 S171P probably benign Het
Tprkb T A 6: 85,916,190 probably null Het
Tspan11 G A 6: 127,939,098 S119N probably benign Het
Ulk2 A T 11: 61,781,746 V922D probably damaging Het
Zfp976 A C 7: 42,614,186 Y76D probably damaging Het
Zkscan2 G A 7: 123,489,770 T426I probably benign Het
Other mutations in Atp10b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Atp10b APN 11 43202161 missense probably damaging 1.00
IGL01385:Atp10b APN 11 43234429 missense probably damaging 1.00
IGL01524:Atp10b APN 11 43259845 missense probably benign 0.18
IGL01575:Atp10b APN 11 43172721 missense probably benign 0.00
IGL01588:Atp10b APN 11 43172721 missense probably benign 0.00
IGL01590:Atp10b APN 11 43172721 missense probably benign 0.00
IGL01832:Atp10b APN 11 43234435 missense probably damaging 0.98
IGL01927:Atp10b APN 11 43259404 splice site probably benign
IGL01933:Atp10b APN 11 43194630 missense probably damaging 1.00
IGL02182:Atp10b APN 11 43248947 missense probably damaging 1.00
IGL02215:Atp10b APN 11 43194665 critical splice donor site probably null
IGL02216:Atp10b APN 11 43259789 missense probably damaging 0.98
IGL02973:Atp10b APN 11 43197509 missense probably damaging 1.00
IGL03012:Atp10b APN 11 43194655 missense probably damaging 0.99
IGL03106:Atp10b APN 11 43247477 missense probably benign 0.32
IGL03123:Atp10b APN 11 43153283 missense probably benign 0.01
IGL03202:Atp10b APN 11 43234441 critical splice donor site probably null
IGL03339:Atp10b APN 11 43230615 missense probably null 0.71
R0053:Atp10b UTSW 11 43216564 splice site probably benign
R0053:Atp10b UTSW 11 43216564 splice site probably benign
R0098:Atp10b UTSW 11 43189604 missense probably benign 0.00
R0098:Atp10b UTSW 11 43189604 missense probably benign 0.00
R0281:Atp10b UTSW 11 43153304 missense probably benign 0.00
R0379:Atp10b UTSW 11 43254314 missense probably benign 0.05
R0380:Atp10b UTSW 11 43225597 missense probably damaging 1.00
R0470:Atp10b UTSW 11 43203039 missense possibly damaging 0.88
R1355:Atp10b UTSW 11 43151655 nonsense probably null
R1368:Atp10b UTSW 11 43202154 missense probably damaging 1.00
R1370:Atp10b UTSW 11 43151655 nonsense probably null
R1413:Atp10b UTSW 11 43230564 missense probably benign 0.00
R1502:Atp10b UTSW 11 43230347 missense probably damaging 1.00
R1530:Atp10b UTSW 11 43197524 missense probably benign 0.03
R1596:Atp10b UTSW 11 43235767 missense probably damaging 1.00
R1675:Atp10b UTSW 11 43225648 missense probably damaging 1.00
R1880:Atp10b UTSW 11 43259432 missense probably damaging 1.00
R1938:Atp10b UTSW 11 43230418 missense probably benign 0.00
R1986:Atp10b UTSW 11 43172768 missense probably benign 0.12
R2081:Atp10b UTSW 11 43202128 missense probably damaging 1.00
R2083:Atp10b UTSW 11 43212423 missense probably benign 0.24
R2159:Atp10b UTSW 11 43151853 missense possibly damaging 0.81
R2255:Atp10b UTSW 11 43234380 missense probably damaging 1.00
R2259:Atp10b UTSW 11 43172745 missense probably damaging 1.00
R2259:Atp10b UTSW 11 43189613 missense probably damaging 1.00
R3741:Atp10b UTSW 11 43235662 missense probably damaging 1.00
R3942:Atp10b UTSW 11 43172754 missense probably damaging 1.00
R3971:Atp10b UTSW 11 43216512 missense probably damaging 1.00
R4007:Atp10b UTSW 11 43259852 missense probably benign 0.04
R4050:Atp10b UTSW 11 43259536 missense probably benign 0.00
R4078:Atp10b UTSW 11 43153283 missense probably benign 0.01
R4567:Atp10b UTSW 11 43197557 missense probably benign 0.03
R4651:Atp10b UTSW 11 43194645 missense probably damaging 1.00
R4652:Atp10b UTSW 11 43194645 missense probably damaging 1.00
R4667:Atp10b UTSW 11 43247518 missense probably damaging 1.00
R4720:Atp10b UTSW 11 43203122 missense probably benign
R4987:Atp10b UTSW 11 43151613 utr 5 prime probably benign
R5232:Atp10b UTSW 11 43202179 missense probably damaging 1.00
R5233:Atp10b UTSW 11 43230560 missense probably benign 0.06
R5281:Atp10b UTSW 11 43254336 missense probably damaging 0.97
R5307:Atp10b UTSW 11 43212475 missense probably damaging 1.00
R5460:Atp10b UTSW 11 43230455 missense probably benign 0.00
R5518:Atp10b UTSW 11 43151636 missense possibly damaging 0.84
R5659:Atp10b UTSW 11 43245425 missense probably damaging 1.00
R5688:Atp10b UTSW 11 43201173 missense probably benign 0.00
R5735:Atp10b UTSW 11 43151774 missense probably benign 0.00
R6251:Atp10b UTSW 11 43235746 missense possibly damaging 0.95
R6259:Atp10b UTSW 11 43201238 missense probably benign 0.24
R6394:Atp10b UTSW 11 43225637 missense probably damaging 1.00
R6492:Atp10b UTSW 11 43218957 missense probably damaging 1.00
R6769:Atp10b UTSW 11 43203252 critical splice donor site probably null
R6771:Atp10b UTSW 11 43203252 critical splice donor site probably null
R6775:Atp10b UTSW 11 43222213 missense possibly damaging 0.80
R7134:Atp10b UTSW 11 43245464 missense probably damaging 1.00
R7322:Atp10b UTSW 11 43212547 missense probably damaging 1.00
R7367:Atp10b UTSW 11 43247501 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGTTAACTAAGCGGTGTGC -3'
(R):5'- ACTTTCTGAGCATGGGAGC -3'

Sequencing Primer
(F):5'- GCATTTTGCTGCTCCACAATCTAAC -3'
(R):5'- CCATGTGACAGGCTCCATGATAG -3'
Posted On2017-10-10