Incidental Mutation 'R6153:Sos1'
ID489415
Institutional Source Beutler Lab
Gene Symbol Sos1
Ensembl Gene ENSMUSG00000024241
Gene NameSOS Ras/Rac guanine nucleotide exchange factor 1
Synonyms4430401P03Rik
MMRRC Submission 044300-MU
Accession Numbers

Genbank: NM_009231.2; Ensembl: ENSMUST00000068714

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6153 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location80393752-80480453 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 80449335 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 263 (I263L)
Ref Sequence ENSEMBL: ENSMUSP00000067786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068714]
PDB Structure
CRK SH3 DOMAIN COMPLEXED WITH PEPTOID INHIBITOR [X-RAY DIFFRACTION]
SOLUTION NMR STRUCTURE OF THE GRB2 N-TERMINAL SH3 DOMAIN COMPLEXED WITH A TEN-RESIDUE PEPTIDE DERIVED FROM SOS DIRECT REFINEMENT AGAINST NOES, J-COUPLINGS, AND 1H AND 13C CHEMICAL SHIFTS, MINIMIZED AVERAGE STRUCTURE [SOLUTION NMR]
PLECKSTRIN HOMOLOGY DOMAIN OF SON OF SEVENLESS 1 (SOS1) WITH GLYCINE-SERINE ADDED TO THE N-TERMINUS, NMR, 20 STRUCTURES [SOLUTION NMR]
SOLUTION NMR STRUCTURE OF THE GRB2 N-TERMINAL SH3 DOMAIN COMPLEXED WITH A TEN-RESIDUE PEPTIDE DERIVED FROM SOS DIRECT REFINEMENT AGAINST NOES, J-COUPLINGS, AND 1H AND 13C CHEMICAL SHIFTS, 15 STRUCTURES [SOLUTION NMR]
SOLUTION NMR STRUCTURE OF THE GRB2 N-TERMINAL SH3 DOMAIN COMPLEXED WITH A TEN-RESIDUE PEPTIDE DERIVED FROM SOS DIRECT REFINEMENT AGAINST NOES, J-COUPLINGS, AND 1H AND 13C CHEMICAL SHIFTS, MINIMIZED AVERAGE STRUCTURE [SOLUTION NMR]
SOLUTION NMR STRUCTURE OF THE GRB2 N-TERMINAL SH3 DOMAIN COMPLEXED WITH A TEN-RESIDUE PEPTIDE DERIVED FROM SOS DIRECT REFINEMENT AGAINST NOES, J-COUPLINGS, AND 1H AND 13C CHEMICAL SHIFTS, 15 STRUCTURES [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000068714
AA Change: I263L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000067786
Gene: ENSMUSG00000024241
AA Change: I263L

DomainStartEndE-ValueType
Pfam:Histone 40 169 6.8e-16 PFAM
RhoGEF 204 389 8.5e-35 SMART
PH 444 548 2.44e-17 SMART
RasGEFN 596 741 2.18e-56 SMART
RasGEF 776 1020 4.44e-102 SMART
low complexity region 1079 1093 N/A INTRINSIC
low complexity region 1116 1127 N/A INTRINSIC
low complexity region 1132 1154 N/A INTRINSIC
Blast:RasGEF 1155 1306 1e-51 BLAST
Meta Mutation Damage Score 0.086 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.3%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a guanine nucleotide exchange factor for RAS proteins, membrane proteins that bind guanine nucleotides and participate in signal transduction pathways. GTP binding activates and GTP hydrolysis inactivates RAS proteins. The product of this gene may regulate RAS proteins by facilitating the exchange of GTP for GDP. Mutations in this gene are associated with gingival fibromatosis 1 and Noonan syndrome type 4. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutant embryos exhibit placental and cardiovascular defects resulting in death around mid-gestation. When heterozygous, these mutations enhance the eye defects of homozygous mutants of the epidermal growth factor receptor gene. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted, knock-out(2) Targeted, other(2) Gene trapped(21)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G T 11: 9,301,259 probably null Het
Ache T C 5: 137,291,855 I394T probably damaging Het
Acsm1 G A 7: 119,633,066 G62D probably damaging Het
Actrt3 T A 3: 30,599,750 I34F probably damaging Het
Adgrf5 T C 17: 43,451,083 I1223T possibly damaging Het
Adora2a T C 10: 75,326,147 F40S possibly damaging Het
Ano8 T C 8: 71,480,797 probably benign Het
Arid1b T A 17: 5,242,832 L675Q probably damaging Het
Atg2b T C 12: 105,623,482 I1837V possibly damaging Het
Atp10b A G 11: 43,254,282 Y1284C probably damaging Het
B3gnt7 G T 1: 86,305,515 G44V probably damaging Het
Chrna1 G T 2: 73,573,309 H99N probably benign Het
Cnksr1 T C 4: 134,233,893 H220R probably damaging Het
Cpsf2 T A 12: 101,999,360 probably null Het
D3Ertd254e A G 3: 36,165,154 H442R possibly damaging Het
Daglb T C 5: 143,503,341 L651P probably benign Het
Ddx60 A G 8: 61,945,940 D231G possibly damaging Het
Ehd4 A C 2: 120,102,423 F174C probably damaging Het
Emsy G T 7: 98,610,853 P9T probably damaging Het
Fnbp1l T C 3: 122,559,156 E217G probably benign Het
Gm11596 A T 11: 99,792,698 C199S unknown Het
Gmps T G 3: 64,001,543 C489G probably benign Het
Gpsm1 T C 2: 26,325,413 Y296H probably benign Het
Heatr5b T C 17: 78,831,441 T91A possibly damaging Het
Hs3st3b1 A T 11: 63,889,498 W268R probably damaging Het
Il27ra T C 8: 84,032,144 probably null Het
Itga5 T A 15: 103,357,453 I156F probably damaging Het
Kcnmb3 T A 3: 32,473,827 D96V probably damaging Het
Khdrbs1 T A 4: 129,716,172 N417Y probably damaging Het
Loxhd1 A G 18: 77,295,758 N118D possibly damaging Het
Mdm4 A G 1: 132,992,107 L341P probably damaging Het
Mecom T C 3: 29,993,648 E225G possibly damaging Het
Megf8 G A 7: 25,347,371 G1560S possibly damaging Het
Mfsd13a A T 19: 46,367,882 D142V probably damaging Het
Muc5b A T 7: 141,861,444 Y2709F possibly damaging Het
Nelfa A T 5: 33,898,879 I480N probably damaging Het
Olfr1329 G A 4: 118,916,747 S240F probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Palld G T 8: 61,550,152 N304K probably damaging Het
Pcsk5 A G 19: 17,511,492 L988P probably damaging Het
Prmt1 A T 7: 44,981,827 F34I probably damaging Het
Pzp A G 6: 128,489,016 S1234P probably benign Het
Ralb A T 1: 119,478,140 probably null Het
Robo2 T A 16: 73,920,729 D141V probably damaging Het
Rsrc1 T C 3: 67,355,562 I283T probably benign Het
Sec62 A T 3: 30,810,482 K165M unknown Het
Sez6 A G 11: 77,977,822 D974G probably damaging Het
Shc2 T A 10: 79,629,918 I187F possibly damaging Het
Shroom3 G A 5: 92,964,408 R1876Q probably damaging Het
Siglecg C A 7: 43,412,017 N481K possibly damaging Het
Skil T A 3: 31,097,853 F175I probably damaging Het
Slc1a1 T C 19: 28,909,535 V432A probably damaging Het
Slit3 G T 11: 35,700,483 G1374V possibly damaging Het
Snx14 T C 9: 88,391,806 Y644C probably damaging Het
Snx33 T A 9: 56,926,699 I29F possibly damaging Het
Susd2 C T 10: 75,638,019 A581T probably damaging Het
Tbpl2 C A 2: 24,076,016 V320F probably damaging Het
Tmem209 A G 6: 30,505,795 S171P probably benign Het
Tprkb T A 6: 85,916,190 probably null Het
Tspan11 G A 6: 127,939,098 S119N probably benign Het
Ulk2 A T 11: 61,781,746 V922D probably damaging Het
Zfp976 A C 7: 42,614,186 Y76D probably damaging Het
Zkscan2 G A 7: 123,489,770 T426I probably benign Het
Other mutations in Sos1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00805:Sos1 APN 17 80398524 missense possibly damaging 0.94
IGL00915:Sos1 APN 17 80433938 missense probably benign 0.00
IGL00929:Sos1 APN 17 80408596 missense probably damaging 1.00
IGL01073:Sos1 APN 17 80422747 missense probably damaging 1.00
IGL01116:Sos1 APN 17 80445500 missense probably damaging 1.00
IGL01533:Sos1 APN 17 80415082 missense probably damaging 0.97
IGL01546:Sos1 APN 17 80408611 missense probably damaging 1.00
IGL01583:Sos1 APN 17 80433900 missense probably benign 0.11
IGL01628:Sos1 APN 17 80422677 splice site probably benign
IGL01837:Sos1 APN 17 80422728 missense probably damaging 1.00
IGL02170:Sos1 APN 17 80398290 missense probably damaging 0.99
IGL02426:Sos1 APN 17 80434943 missense possibly damaging 0.82
IGL02992:Sos1 APN 17 80419016 missense probably benign 0.01
IGL03037:Sos1 APN 17 80420329 missense probably damaging 0.98
1mM(1):Sos1 UTSW 17 80455057 missense possibly damaging 0.46
PIT4354001:Sos1 UTSW 17 80449356 missense possibly damaging 0.52
R0056:Sos1 UTSW 17 80413621 missense probably damaging 1.00
R0348:Sos1 UTSW 17 80408311 missense probably benign
R0373:Sos1 UTSW 17 80453763 missense probably damaging 1.00
R0477:Sos1 UTSW 17 80434934 missense possibly damaging 0.92
R0621:Sos1 UTSW 17 80451979 critical splice donor site probably null
R0839:Sos1 UTSW 17 80433730 missense probably damaging 1.00
R1174:Sos1 UTSW 17 80445608 nonsense probably null
R1490:Sos1 UTSW 17 80413675 missense probably benign 0.11
R1566:Sos1 UTSW 17 80453916 missense probably damaging 0.99
R1635:Sos1 UTSW 17 80422679 splice site probably null
R3412:Sos1 UTSW 17 80406717 missense probably benign
R3770:Sos1 UTSW 17 80398308 missense probably damaging 0.97
R3951:Sos1 UTSW 17 80424181 missense probably damaging 1.00
R3964:Sos1 UTSW 17 80455179 missense probably damaging 1.00
R3966:Sos1 UTSW 17 80455179 missense probably damaging 1.00
R4086:Sos1 UTSW 17 80449352 missense probably benign 0.06
R4087:Sos1 UTSW 17 80449352 missense probably benign 0.06
R4089:Sos1 UTSW 17 80449352 missense probably benign 0.06
R4194:Sos1 UTSW 17 80398584 missense probably benign 0.02
R4468:Sos1 UTSW 17 80453811 missense probably damaging 1.00
R4469:Sos1 UTSW 17 80453811 missense probably damaging 1.00
R4597:Sos1 UTSW 17 80433826 missense probably benign 0.05
R4773:Sos1 UTSW 17 80398231 missense probably damaging 0.99
R4923:Sos1 UTSW 17 80434952 missense probably benign 0.10
R5120:Sos1 UTSW 17 80408248 missense probably damaging 0.98
R5478:Sos1 UTSW 17 80433847 missense probably damaging 1.00
R5566:Sos1 UTSW 17 80453890 missense possibly damaging 0.91
R5984:Sos1 UTSW 17 80452132 missense possibly damaging 0.68
R6053:Sos1 UTSW 17 80415034 missense possibly damaging 0.94
R6567:Sos1 UTSW 17 80433503 missense probably damaging 1.00
R7392:Sos1 UTSW 17 80424200 missense probably damaging 1.00
X0020:Sos1 UTSW 17 80449277 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGACTTGAGCTGGAAATAGG -3'
(R):5'- CGCCATCCTTATTCCCAGAAAG -3'

Sequencing Primer
(F):5'- CTGGAAATAGGAATTATGAACCCC -3'
(R):5'- TGTTCTCCAGCCACAACAGACTG -3'
Posted On2017-10-10