Incidental Mutation 'R6154:Zp3r'
ID489424
Institutional Source Beutler Lab
Gene Symbol Zp3r
Ensembl Gene ENSMUSG00000042554
Gene Namezona pellucida 3 receptor
SynonymsSP56
MMRRC Submission 044301-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.169) question?
Stock #R6154 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location130576713-130629621 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 130598905 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 187 (C187Y)
Ref Sequence ENSEMBL: ENSMUSP00000045443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039862] [ENSMUST00000128128] [ENSMUST00000142416]
Predicted Effect probably damaging
Transcript: ENSMUST00000039862
AA Change: C187Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045443
Gene: ENSMUSG00000042554
AA Change: C187Y

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
CCP 34 91 2.52e-7 SMART
CCP 96 153 3.17e-13 SMART
CCP 158 218 8.23e-12 SMART
CCP 223 278 1.77e-11 SMART
CCP 283 345 5.32e-6 SMART
CCP 350 411 3.67e-9 SMART
CCP 456 509 6.95e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082461
Predicted Effect probably benign
Transcript: ENSMUST00000128128
SMART Domains Protein: ENSMUSP00000114401
Gene: ENSMUSG00000042554

DomainStartEndE-ValueType
CCP 55 112 2.52e-7 SMART
CCP 117 174 3.17e-13 SMART
CCP 179 234 1.77e-11 SMART
CCP 239 301 5.32e-6 SMART
CCP 306 367 3.67e-9 SMART
CCP 412 465 6.95e-10 SMART
PDB:4B0F|G 468 513 8e-8 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000142416
SMART Domains Protein: ENSMUSP00000118784
Gene: ENSMUSG00000042554

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
CCP 34 91 2.52e-7 SMART
CCP 96 153 3.17e-13 SMART
CCP 158 213 1.77e-11 SMART
CCP 218 280 5.32e-6 SMART
CCP 285 346 3.67e-9 SMART
CCP 391 444 6.95e-10 SMART
PDB:4B0F|G 447 492 8e-8 PDB
Meta Mutation Damage Score 0.0216 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.8%
Validation Efficiency 97% (70/72)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal fertility and sperm morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss3 T G 10: 107,123,349 I79L probably benign Het
Adam6a C T 12: 113,545,672 T555I probably benign Het
Adap1 A G 5: 139,307,776 V60A possibly damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Angpt1 T C 15: 42,523,655 E101G probably damaging Het
Asxl2 T C 12: 3,496,593 V459A possibly damaging Het
Cabs1 C T 5: 87,979,754 T88I possibly damaging Het
Camta2 G A 11: 70,678,385 A578V probably damaging Het
Cdc16 A G 8: 13,768,609 N316D possibly damaging Het
Chrm3 T A 13: 9,878,440 M187L possibly damaging Het
Clcn4 T C 7: 7,291,482 T367A probably benign Het
Clcn7 T C 17: 25,157,954 S654P probably damaging Het
Col6a3 T A 1: 90,773,665 T2510S unknown Het
Crisp4 T C 1: 18,122,788 E192G possibly damaging Het
Dmbt1 T A 7: 131,109,641 probably null Het
Dnah5 T G 15: 28,204,031 L18R probably benign Het
Dnah9 T G 11: 65,855,338 D3983A probably benign Het
Dock5 C A 14: 67,859,912 V71L probably benign Het
Dync1h1 T C 12: 110,617,993 V610A probably damaging Het
Dynlrb2 A G 8: 116,515,689 Y86C probably benign Het
Ep400 T C 5: 110,755,933 I267V probably damaging Het
Gaa A G 11: 119,278,352 Y575C probably damaging Het
Gm8094 T A 14: 43,076,563 D24V probably benign Het
Gm884 A G 11: 103,614,143 V2333A probably benign Het
Grina T C 15: 76,248,887 I244T possibly damaging Het
Haus6 A G 4: 86,583,756 L626P possibly damaging Het
Hexdc A T 11: 121,221,271 H439L probably benign Het
Ifna12 A T 4: 88,603,294 C5* probably null Het
Igf2bp2 G T 16: 22,076,093 S300* probably null Het
Ighv6-5 T C 12: 114,416,742 R71G probably benign Het
Lrrn4cl T C 19: 8,851,888 S77P probably damaging Het
Mast4 A G 13: 102,787,421 L302P probably damaging Het
Mink1 T C 11: 70,610,101 V831A possibly damaging Het
Mme T A 3: 63,300,253 I40N probably damaging Het
Myh2 A G 11: 67,186,612 T858A probably benign Het
Ncbp3 T A 11: 73,049,874 Y67N probably damaging Het
Nedd1 T A 10: 92,698,242 I349F possibly damaging Het
Nek11 A T 9: 105,323,169 *81K probably null Het
Nrip1 A G 16: 76,293,830 Y280H probably damaging Het
Obsl1 T C 1: 75,500,144 D722G probably benign Het
Olfr1117-ps1 T G 2: 87,309,558 S256R probably benign Het
Olfr1209 A G 2: 88,910,390 M1T probably null Het
Olfr152 A G 2: 87,782,756 D72G possibly damaging Het
Olfr164 A T 16: 19,286,431 I104K probably damaging Het
Olfr789 C T 10: 129,487,676 T222I probably damaging Het
Pcdhb6 A G 18: 37,334,913 I296V probably benign Het
Pcnx2 G T 8: 125,762,813 L1681M probably damaging Het
Pdlim5 T C 3: 142,277,913 R360G possibly damaging Het
Peli2 C T 14: 48,250,594 Q81* probably null Het
Pitpnb C T 5: 111,338,397 Q56* probably null Het
Ppp1r3a A G 6: 14,754,604 S215P possibly damaging Het
Prrt3 A G 6: 113,495,028 Y728H probably damaging Het
Rsf1 A AAGGCGACGG 7: 97,579,904 probably null Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Sbno1 T C 5: 124,378,479 H1277R possibly damaging Het
Siglecg C A 7: 43,412,017 N481K possibly damaging Het
Sirt6 C T 10: 81,626,505 G20D probably damaging Het
Sit1 C A 4: 43,482,981 R89S probably benign Het
Slc7a12 A G 3: 14,481,034 R80G probably damaging Het
Smok3c T A 5: 138,064,485 M78K probably benign Het
Stk10 T A 11: 32,603,654 probably null Het
Tada2b A G 5: 36,476,664 V190A probably damaging Het
Tnk1 C T 11: 69,856,954 V41I probably damaging Het
Tpr T A 1: 150,423,816 V1146E probably benign Het
Trappc9 T C 15: 73,058,081 D142G probably benign Het
Trpm3 T C 19: 22,987,814 Y1558H probably damaging Het
Unc5c C A 3: 141,678,153 S97R probably damaging Het
Vmn1r172 T C 7: 23,660,158 I156T probably damaging Het
Vmn2r51 A T 7: 10,087,994 M588K possibly damaging Het
Vps26a T G 10: 62,468,340 E117D probably damaging Het
Zfp451 A T 1: 33,803,546 probably benign Het
Zfp534 C A 4: 147,674,688 R508I probably benign Het
Other mutations in Zp3r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01352:Zp3r APN 1 130619356 missense possibly damaging 0.88
IGL01783:Zp3r APN 1 130598866 missense possibly damaging 0.72
IGL01820:Zp3r APN 1 130598920 missense probably benign 0.01
IGL01959:Zp3r APN 1 130591451 nonsense probably null
IGL01978:Zp3r APN 1 130598941 missense probably damaging 1.00
IGL02232:Zp3r APN 1 130596667 missense probably damaging 1.00
IGL02290:Zp3r APN 1 130619365 missense possibly damaging 0.89
IGL02878:Zp3r APN 1 130582851 missense probably benign 0.02
IGL02960:Zp3r APN 1 130583438 missense possibly damaging 0.67
R0433:Zp3r UTSW 1 130577133 splice site probably benign
R0491:Zp3r UTSW 1 130618334 missense probably damaging 1.00
R0781:Zp3r UTSW 1 130577884 critical splice donor site probably null
R1110:Zp3r UTSW 1 130577884 critical splice donor site probably null
R1126:Zp3r UTSW 1 130618342 missense probably damaging 1.00
R1295:Zp3r UTSW 1 130591444 missense probably damaging 1.00
R1680:Zp3r UTSW 1 130582880 missense probably benign 0.15
R1728:Zp3r UTSW 1 130596814 missense probably benign 0.00
R1728:Zp3r UTSW 1 130619414 missense possibly damaging 0.68
R1729:Zp3r UTSW 1 130596814 missense probably benign 0.00
R1729:Zp3r UTSW 1 130619414 missense possibly damaging 0.68
R1730:Zp3r UTSW 1 130596814 missense probably benign 0.00
R1730:Zp3r UTSW 1 130619414 missense possibly damaging 0.68
R1739:Zp3r UTSW 1 130596814 missense probably benign 0.00
R1739:Zp3r UTSW 1 130619414 missense possibly damaging 0.68
R1762:Zp3r UTSW 1 130596814 missense probably benign 0.00
R1762:Zp3r UTSW 1 130619414 missense possibly damaging 0.68
R1783:Zp3r UTSW 1 130596814 missense probably benign 0.00
R1783:Zp3r UTSW 1 130619414 missense possibly damaging 0.68
R1784:Zp3r UTSW 1 130596814 missense probably benign 0.00
R1784:Zp3r UTSW 1 130619414 missense possibly damaging 0.68
R1785:Zp3r UTSW 1 130596814 missense probably benign 0.00
R1785:Zp3r UTSW 1 130619414 missense possibly damaging 0.68
R3942:Zp3r UTSW 1 130577054 missense possibly damaging 0.94
R4429:Zp3r UTSW 1 130591391 missense possibly damaging 0.95
R4571:Zp3r UTSW 1 130578020 missense probably damaging 1.00
R4626:Zp3r UTSW 1 130615175 missense probably damaging 1.00
R4647:Zp3r UTSW 1 130577960 missense probably damaging 1.00
R4790:Zp3r UTSW 1 130582892 missense probably damaging 1.00
R4815:Zp3r UTSW 1 130598912 missense probably damaging 1.00
R5355:Zp3r UTSW 1 130596781 missense probably benign 0.09
R5554:Zp3r UTSW 1 130583471 missense probably benign 0.42
R5629:Zp3r UTSW 1 130582879 missense probably damaging 0.99
R6173:Zp3r UTSW 1 130591568 splice site probably null
R6949:Zp3r UTSW 1 130577895 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGTGGCCTGCACCTTATTC -3'
(R):5'- CCTTCCGACATGATAATATGACAC -3'

Sequencing Primer
(F):5'- GTGGCCTGCACCTTATTCCTATAAAC -3'
(R):5'- ATATACTATTTGAGTCTCTCTTGCCC -3'
Posted On2017-10-10