Incidental Mutation 'R6154:Pcnx2'
ID489453
Institutional Source Beutler Lab
Gene Symbol Pcnx2
Ensembl Gene ENSMUSG00000060212
Gene Namepecanex homolog 2
SynonymsPcnxl2, E330039K12Rik
MMRRC Submission 044301-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.171) question?
Stock #R6154 (G1)
Quality Score202.009
Status Validated
Chromosome8
Chromosomal Location125751508-125898317 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 125762813 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Methionine at position 1681 (L1681M)
Ref Sequence ENSEMBL: ENSMUSP00000042294 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047239]
Predicted Effect probably damaging
Transcript: ENSMUST00000047239
AA Change: L1681M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042294
Gene: ENSMUSG00000060212
AA Change: L1681M

DomainStartEndE-ValueType
transmembrane domain 36 53 N/A INTRINSIC
transmembrane domain 60 82 N/A INTRINSIC
low complexity region 94 104 N/A INTRINSIC
low complexity region 391 415 N/A INTRINSIC
low complexity region 457 476 N/A INTRINSIC
low complexity region 727 742 N/A INTRINSIC
low complexity region 806 817 N/A INTRINSIC
transmembrane domain 823 842 N/A INTRINSIC
transmembrane domain 849 866 N/A INTRINSIC
transmembrane domain 881 902 N/A INTRINSIC
transmembrane domain 934 956 N/A INTRINSIC
transmembrane domain 976 998 N/A INTRINSIC
transmembrane domain 1011 1030 N/A INTRINSIC
transmembrane domain 1080 1102 N/A INTRINSIC
transmembrane domain 1104 1126 N/A INTRINSIC
Pfam:Pecanex_C 1603 1828 3.5e-113 PFAM
low complexity region 1864 1889 N/A INTRINSIC
low complexity region 1968 1981 N/A INTRINSIC
low complexity region 2004 2019 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119305
SMART Domains Protein: ENSMUSP00000113149
Gene: ENSMUSG00000060212

DomainStartEndE-ValueType
Pfam:Pecanex_C 157 386 1.8e-122 PFAM
low complexity region 421 446 N/A INTRINSIC
low complexity region 525 538 N/A INTRINSIC
low complexity region 561 576 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120589
SMART Domains Protein: ENSMUSP00000113111
Gene: ENSMUSG00000060212

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Pecanex_C 533 762 4e-122 PFAM
low complexity region 797 822 N/A INTRINSIC
low complexity region 901 914 N/A INTRINSIC
low complexity region 937 952 N/A INTRINSIC
Meta Mutation Damage Score 0.03 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.8%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene contains coding mononucleotide repeats that are associated with tumors of high mcrosatellite instability (MSI-H). Defects in this gene are involved in the tumorigenesis of MSI-H colorectal carcinomas. [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss3 T G 10: 107,123,349 I79L probably benign Het
Adam6a C T 12: 113,545,672 T555I probably benign Het
Adap1 A G 5: 139,307,776 V60A possibly damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Angpt1 T C 15: 42,523,655 E101G probably damaging Het
Asxl2 T C 12: 3,496,593 V459A possibly damaging Het
Cabs1 C T 5: 87,979,754 T88I possibly damaging Het
Camta2 G A 11: 70,678,385 A578V probably damaging Het
Cdc16 A G 8: 13,768,609 N316D possibly damaging Het
Chrm3 T A 13: 9,878,440 M187L possibly damaging Het
Clcn4 T C 7: 7,291,482 T367A probably benign Het
Clcn7 T C 17: 25,157,954 S654P probably damaging Het
Col6a3 T A 1: 90,773,665 T2510S unknown Het
Crisp4 T C 1: 18,122,788 E192G possibly damaging Het
Dmbt1 T A 7: 131,109,641 probably null Het
Dnah5 T G 15: 28,204,031 L18R probably benign Het
Dnah9 T G 11: 65,855,338 D3983A probably benign Het
Dock5 C A 14: 67,859,912 V71L probably benign Het
Dync1h1 T C 12: 110,617,993 V610A probably damaging Het
Dynlrb2 A G 8: 116,515,689 Y86C probably benign Het
Ep400 T C 5: 110,755,933 I267V probably damaging Het
Gaa A G 11: 119,278,352 Y575C probably damaging Het
Gm8094 T A 14: 43,076,563 D24V probably benign Het
Gm884 A G 11: 103,614,143 V2333A probably benign Het
Grina T C 15: 76,248,887 I244T possibly damaging Het
Haus6 A G 4: 86,583,756 L626P possibly damaging Het
Hexdc A T 11: 121,221,271 H439L probably benign Het
Ifna12 A T 4: 88,603,294 C5* probably null Het
Igf2bp2 G T 16: 22,076,093 S300* probably null Het
Ighv6-5 T C 12: 114,416,742 R71G probably benign Het
Lrrn4cl T C 19: 8,851,888 S77P probably damaging Het
Mast4 A G 13: 102,787,421 L302P probably damaging Het
Mink1 T C 11: 70,610,101 V831A possibly damaging Het
Mme T A 3: 63,300,253 I40N probably damaging Het
Myh2 A G 11: 67,186,612 T858A probably benign Het
Ncbp3 T A 11: 73,049,874 Y67N probably damaging Het
Nedd1 T A 10: 92,698,242 I349F possibly damaging Het
Nek11 A T 9: 105,323,169 *81K probably null Het
Nrip1 A G 16: 76,293,830 Y280H probably damaging Het
Obsl1 T C 1: 75,500,144 D722G probably benign Het
Olfr1117-ps1 T G 2: 87,309,558 S256R probably benign Het
Olfr1209 A G 2: 88,910,390 M1T probably null Het
Olfr152 A G 2: 87,782,756 D72G possibly damaging Het
Olfr164 A T 16: 19,286,431 I104K probably damaging Het
Olfr789 C T 10: 129,487,676 T222I probably damaging Het
Pcdhb6 A G 18: 37,334,913 I296V probably benign Het
Pdlim5 T C 3: 142,277,913 R360G possibly damaging Het
Peli2 C T 14: 48,250,594 Q81* probably null Het
Pitpnb C T 5: 111,338,397 Q56* probably null Het
Ppp1r3a A G 6: 14,754,604 S215P possibly damaging Het
Prrt3 A G 6: 113,495,028 Y728H probably damaging Het
Rsf1 A AAGGCGACGG 7: 97,579,904 probably null Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Sbno1 T C 5: 124,378,479 H1277R possibly damaging Het
Siglecg C A 7: 43,412,017 N481K possibly damaging Het
Sirt6 C T 10: 81,626,505 G20D probably damaging Het
Sit1 C A 4: 43,482,981 R89S probably benign Het
Slc7a12 A G 3: 14,481,034 R80G probably damaging Het
Smok3c T A 5: 138,064,485 M78K probably benign Het
Stk10 T A 11: 32,603,654 probably null Het
Tada2b A G 5: 36,476,664 V190A probably damaging Het
Tnk1 C T 11: 69,856,954 V41I probably damaging Het
Tpr T A 1: 150,423,816 V1146E probably benign Het
Trappc9 T C 15: 73,058,081 D142G probably benign Het
Trpm3 T C 19: 22,987,814 Y1558H probably damaging Het
Unc5c C A 3: 141,678,153 S97R probably damaging Het
Vmn1r172 T C 7: 23,660,158 I156T probably damaging Het
Vmn2r51 A T 7: 10,087,994 M588K possibly damaging Het
Vps26a T G 10: 62,468,340 E117D probably damaging Het
Zfp451 A T 1: 33,803,546 probably benign Het
Zfp534 C A 4: 147,674,688 R508I probably benign Het
Zp3r C T 1: 130,598,905 C187Y probably damaging Het
Other mutations in Pcnx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Pcnx2 APN 8 125887585 missense probably damaging 1.00
IGL00900:Pcnx2 APN 8 125863236 splice site probably benign
IGL01134:Pcnx2 APN 8 125863150 missense probably benign
IGL01370:Pcnx2 APN 8 125801483 missense probably damaging 0.96
IGL01452:Pcnx2 APN 8 125838032 missense probably damaging 1.00
IGL01477:Pcnx2 APN 8 125785305 missense probably damaging 1.00
IGL01610:Pcnx2 APN 8 125839633 missense possibly damaging 0.67
IGL01640:Pcnx2 APN 8 125801558 missense probably benign 0.14
IGL01645:Pcnx2 APN 8 125887917 missense probably damaging 1.00
IGL01876:Pcnx2 APN 8 125866031 missense probably benign 0.31
IGL01933:Pcnx2 APN 8 125761654 missense probably damaging 1.00
IGL02208:Pcnx2 APN 8 125752155 missense probably benign 0.30
IGL02573:Pcnx2 APN 8 125855273 missense probably benign 0.34
IGL02810:Pcnx2 APN 8 125887203 missense probably benign 0.03
IGL02859:Pcnx2 APN 8 125863173 missense probably damaging 1.00
IGL02879:Pcnx2 APN 8 125772057 missense probably damaging 1.00
IGL03202:Pcnx2 APN 8 125772044 missense probably damaging 0.98
IGL03259:Pcnx2 APN 8 125753649 missense probably benign 0.19
IGL03395:Pcnx2 APN 8 125887523 missense probably benign 0.00
IGL03410:Pcnx2 APN 8 125887040 missense probably damaging 1.00
R0107:Pcnx2 UTSW 8 125753586 missense probably benign 0.29
R0477:Pcnx2 UTSW 8 125761567 missense probably damaging 0.99
R0610:Pcnx2 UTSW 8 125839687 missense probably damaging 1.00
R0645:Pcnx2 UTSW 8 125760720 missense possibly damaging 0.64
R0894:Pcnx2 UTSW 8 125886926 splice site probably benign
R1083:Pcnx2 UTSW 8 125772104 missense probably damaging 1.00
R1199:Pcnx2 UTSW 8 125887314 missense possibly damaging 0.60
R1296:Pcnx2 UTSW 8 125773833 missense probably damaging 1.00
R1445:Pcnx2 UTSW 8 125752284 missense probably damaging 0.99
R1467:Pcnx2 UTSW 8 125753550 missense possibly damaging 0.77
R1467:Pcnx2 UTSW 8 125753550 missense possibly damaging 0.77
R1524:Pcnx2 UTSW 8 125891141 missense probably benign 0.00
R1537:Pcnx2 UTSW 8 125877449 missense possibly damaging 0.94
R1574:Pcnx2 UTSW 8 125773930 missense probably damaging 1.00
R1574:Pcnx2 UTSW 8 125773930 missense probably damaging 1.00
R1593:Pcnx2 UTSW 8 125759273 missense probably benign 0.11
R1598:Pcnx2 UTSW 8 125772086 missense probably benign 0.03
R1603:Pcnx2 UTSW 8 125839626 missense probably damaging 1.00
R1697:Pcnx2 UTSW 8 125850348 missense probably damaging 1.00
R1759:Pcnx2 UTSW 8 125773978 missense probably damaging 1.00
R1855:Pcnx2 UTSW 8 125807996 splice site probably benign
R1863:Pcnx2 UTSW 8 125818786 missense probably damaging 0.98
R1930:Pcnx2 UTSW 8 125887714 missense probably benign 0.10
R1967:Pcnx2 UTSW 8 125815683 missense possibly damaging 0.51
R1974:Pcnx2 UTSW 8 125887371 missense probably benign 0.00
R1998:Pcnx2 UTSW 8 125887143 missense probably damaging 1.00
R2034:Pcnx2 UTSW 8 125818667 critical splice donor site probably null
R2072:Pcnx2 UTSW 8 125761742 missense possibly damaging 0.90
R2096:Pcnx2 UTSW 8 125759248 missense probably benign 0.27
R2216:Pcnx2 UTSW 8 125888077 missense probably benign 0.00
R2290:Pcnx2 UTSW 8 125877595 splice site probably benign
R2373:Pcnx2 UTSW 8 125753451 missense probably damaging 1.00
R2484:Pcnx2 UTSW 8 125891120 missense probably damaging 1.00
R2849:Pcnx2 UTSW 8 125760927 missense probably damaging 1.00
R2891:Pcnx2 UTSW 8 125891058 missense probably damaging 1.00
R2892:Pcnx2 UTSW 8 125891058 missense probably damaging 1.00
R2970:Pcnx2 UTSW 8 125801536 missense probably damaging 1.00
R3013:Pcnx2 UTSW 8 125887770 missense probably benign 0.05
R3608:Pcnx2 UTSW 8 125888101 missense probably benign
R3876:Pcnx2 UTSW 8 125888158 missense probably benign
R4349:Pcnx2 UTSW 8 125762851 missense probably damaging 0.98
R4352:Pcnx2 UTSW 8 125762851 missense probably damaging 0.98
R4353:Pcnx2 UTSW 8 125762851 missense probably damaging 0.98
R4361:Pcnx2 UTSW 8 125768298 nonsense probably null
R4735:Pcnx2 UTSW 8 125828041 critical splice donor site probably null
R4749:Pcnx2 UTSW 8 125887588 missense probably damaging 1.00
R4812:Pcnx2 UTSW 8 125865939 missense probably benign 0.00
R4819:Pcnx2 UTSW 8 125855230 missense probably benign 0.04
R4829:Pcnx2 UTSW 8 125861058 intron probably null
R4832:Pcnx2 UTSW 8 125752188 missense probably damaging 0.99
R4876:Pcnx2 UTSW 8 125772108 missense probably damaging 1.00
R4974:Pcnx2 UTSW 8 125851130 missense probably benign 0.00
R5057:Pcnx2 UTSW 8 125855191 missense possibly damaging 0.95
R5078:Pcnx2 UTSW 8 125752156 missense probably benign
R5114:Pcnx2 UTSW 8 125838010 missense possibly damaging 0.89
R5195:Pcnx2 UTSW 8 125801549 missense possibly damaging 0.69
R5239:Pcnx2 UTSW 8 125861082 intron probably null
R5348:Pcnx2 UTSW 8 125818756 missense probably damaging 1.00
R5398:Pcnx2 UTSW 8 125887948 missense possibly damaging 0.63
R5448:Pcnx2 UTSW 8 125888149 missense probably benign 0.14
R5534:Pcnx2 UTSW 8 125838015 missense possibly damaging 0.65
R5624:Pcnx2 UTSW 8 125761523 critical splice donor site probably null
R5629:Pcnx2 UTSW 8 125898041 missense probably damaging 1.00
R5630:Pcnx2 UTSW 8 125860958 missense probably damaging 0.99
R5782:Pcnx2 UTSW 8 125753484 missense probably damaging 1.00
R5877:Pcnx2 UTSW 8 125753728 missense probably damaging 0.99
R5879:Pcnx2 UTSW 8 125773946 missense probably damaging 1.00
R6114:Pcnx2 UTSW 8 125773947 missense probably damaging 1.00
R6152:Pcnx2 UTSW 8 125753752 missense probably damaging 0.99
R6283:Pcnx2 UTSW 8 125877586 missense probably damaging 0.99
R6500:Pcnx2 UTSW 8 125753485 missense probably damaging 1.00
R6629:Pcnx2 UTSW 8 125891112 missense probably benign 0.00
R6708:Pcnx2 UTSW 8 125860953 critical splice donor site probably null
R6736:Pcnx2 UTSW 8 125752317 splice site probably null
R6748:Pcnx2 UTSW 8 125850335 missense probably damaging 1.00
R6788:Pcnx2 UTSW 8 125772100 missense probably damaging 1.00
R6849:Pcnx2 UTSW 8 125861210 missense probably damaging 1.00
R6947:Pcnx2 UTSW 8 125850282 critical splice donor site probably null
R7034:Pcnx2 UTSW 8 125785302 missense probably damaging 1.00
R7100:Pcnx2 UTSW 8 125759114 missense probably benign 0.16
R7124:Pcnx2 UTSW 8 125753617 missense probably damaging 0.99
R7130:Pcnx2 UTSW 8 125753584 nonsense probably null
R7133:Pcnx2 UTSW 8 125801504 missense probably benign 0.01
Z1088:Pcnx2 UTSW 8 125826928 missense probably damaging 1.00
Z1088:Pcnx2 UTSW 8 125866018 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCATGCCACACTCCTTGG -3'
(R):5'- CACAGCATGGTGTGACTGTC -3'

Sequencing Primer
(F):5'- ACTCCTTGGCTGAGTCGAGTC -3'
(R):5'- GACTGTCCTCCAGCTTGTGAG -3'
Posted On2017-10-10