Incidental Mutation 'R6155:Npas2'
ID489491
Institutional Source Beutler Lab
Gene Symbol Npas2
Ensembl Gene ENSMUSG00000026077
Gene Nameneuronal PAS domain protein 2
SynonymsbHLHe9, MOP4
MMRRC Submission 044302-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6155 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location39193731-39363236 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 39287476 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 14 (R14Q)
Ref Sequence ENSEMBL: ENSMUSP00000054719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056815] [ENSMUST00000173050]
Predicted Effect probably damaging
Transcript: ENSMUST00000056815
AA Change: R14Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054719
Gene: ENSMUSG00000026077
AA Change: R14Q

DomainStartEndE-ValueType
HLH 15 65 6.56e-10 SMART
PAS 84 150 4.28e-10 SMART
PAS 239 305 4.03e-6 SMART
PAC 311 354 6.2e-7 SMART
low complexity region 400 419 N/A INTRINSIC
coiled coil region 510 538 N/A INTRINSIC
low complexity region 563 583 N/A INTRINSIC
low complexity region 623 643 N/A INTRINSIC
low complexity region 745 768 N/A INTRINSIC
low complexity region 798 816 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000173050
AA Change: R14Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134241
Gene: ENSMUSG00000026077
AA Change: R14Q

DomainStartEndE-ValueType
HLH 15 60 1.08e-5 SMART
Meta Mutation Damage Score 0.33 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the basic helix-loop-helix (bHLH)-PAS family of transcription factors. The encoded protein may play a regulatory role in the acquisition of specific types of memory. It also may function as a part of a molecular clock operative in the mammalian forebrain. [provided by RefSeq, Dec 2014]
PHENOTYPE: Targeted mutation of this gene results in deficits in complex emotional long-term memory tasks [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 T C 5: 104,963,644 Y319C probably benign Het
Actn4 A C 7: 28,896,141 I763S probably damaging Het
Actr8 G A 14: 29,978,589 probably null Het
Adrb1 T C 19: 56,722,904 L178P probably damaging Het
Afap1 A G 5: 35,935,609 Y19C unknown Het
Ankrd36 A G 11: 5,687,442 E1337G probably benign Het
Arl4a A C 12: 40,036,520 V76G probably damaging Het
B230118H07Rik A T 2: 101,576,010 probably null Het
Bmp1 A T 14: 70,508,007 I246K probably damaging Het
Camk4 A T 18: 32,939,447 T18S unknown Het
Cep152 T C 2: 125,581,700 H927R probably benign Het
Clca3a2 A G 3: 144,819,357 I38T probably damaging Het
Clec2g A C 6: 128,980,273 T54P probably damaging Het
Cox20 A G 1: 178,321,797 E31G possibly damaging Het
Crispld1 T A 1: 17,753,017 H407Q probably benign Het
Csmd1 T C 8: 15,903,231 I3417V probably benign Het
Dhtkd1 A C 2: 5,910,359 H700Q probably null Het
Dnah10 G A 5: 124,770,599 V1516M probably damaging Het
Dnah10 A G 5: 124,785,175 T2165A probably damaging Het
Dock2 C G 11: 34,294,123 M1072I probably benign Het
F11 T A 8: 45,252,082 T141S probably damaging Het
Gabra6 T A 11: 42,316,523 I245F probably damaging Het
Gm13101 T A 4: 143,965,142 H337L probably benign Het
Gm8909 G A 17: 36,167,507 A211V possibly damaging Het
Herc1 T A 9: 66,433,423 C1685S possibly damaging Het
Il20 G T 1: 130,910,740 D73E probably damaging Het
Ireb2 C A 9: 54,886,527 P247Q probably damaging Het
Kcng3 T C 17: 83,588,378 I220V probably benign Het
Lce1j T G 3: 92,789,072 Q133P unknown Het
Lgals9 C T 11: 78,963,505 A287T probably benign Het
Lrrc52 A G 1: 167,466,727 probably benign Het
Map3k5 A T 10: 20,118,441 H1027L probably benign Het
Morc3 A G 16: 93,862,425 D407G possibly damaging Het
Myom1 T C 17: 71,108,695 probably null Het
Ncapg2 T C 12: 116,438,011 F673S possibly damaging Het
Ncoa6 T C 2: 155,407,448 D1312G probably damaging Het
Nkx1-1 A T 5: 33,431,051 F298I probably damaging Het
Npas4 C T 19: 4,986,870 C422Y probably damaging Het
Olfr1230 A G 2: 89,296,421 L283S probably damaging Het
Olfr1381 T A 11: 49,552,584 I279N possibly damaging Het
Olfr481 T C 7: 108,081,286 V164A probably benign Het
Olfr749 T C 14: 50,736,619 D181G probably benign Het
Pcdhga4 T C 18: 37,686,493 I365T probably damaging Het
Pear1 T A 3: 87,759,568 T37S probably damaging Het
Pkn2 A T 3: 142,853,693 F24I probably benign Het
Plcb3 G A 19: 6,966,165 A122V probably damaging Het
Pnliprp1 T C 19: 58,730,133 probably null Het
Psmb3 T A 11: 97,712,452 F164I probably damaging Het
Ptch2 T A 4: 117,096,908 F45Y probably damaging Het
Ptpn23 C A 9: 110,387,781 probably benign Het
Pusl1 A G 4: 155,890,548 S199P probably damaging Het
Rasgrp2 C A 19: 6,402,501 L35I probably damaging Het
Rictor T C 15: 6,793,977 L1545P probably benign Het
Rtn4r A T 16: 18,151,394 M229L probably benign Het
Ruvbl1 A T 6: 88,479,125 probably null Het
Slc35b3 A T 13: 38,944,596 S30T probably damaging Het
Sorcs3 T C 19: 48,398,697 V207A possibly damaging Het
Sox13 A G 1: 133,393,267 S2P probably damaging Het
Sptbn1 A C 11: 30,137,403 L999R probably damaging Het
Taf4 A G 2: 179,913,524 V1015A probably damaging Het
Top3b T C 16: 16,891,509 L687P probably damaging Het
Tpp2 T A 1: 43,956,489 V268E probably damaging Het
Ttc6 T C 12: 57,737,616 Y1824H possibly damaging Het
Txk A G 5: 72,700,726 Y360H probably damaging Het
Vmn2r57 T C 7: 41,428,690 I115V probably benign Het
Vmn2r98 T C 17: 19,065,881 S214P possibly damaging Het
Zbtb48 T C 4: 152,022,038 probably null Het
Zzz3 A G 3: 152,427,682 I126V possibly damaging Het
Other mutations in Npas2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02560:Npas2 APN 1 39333961 splice site probably benign
IGL02608:Npas2 APN 1 39345446 missense probably benign 0.06
IGL02882:Npas2 APN 1 39312996 missense probably benign 0.08
IGL02976:Npas2 APN 1 39287484 missense probably damaging 1.00
IGL03130:Npas2 APN 1 39313028 missense probably damaging 1.00
IGL03297:Npas2 APN 1 39292690 missense possibly damaging 0.71
R1263:Npas2 UTSW 1 39334768 missense possibly damaging 0.51
R1514:Npas2 UTSW 1 39311854 missense possibly damaging 0.82
R1618:Npas2 UTSW 1 39300727 missense probably damaging 1.00
R1620:Npas2 UTSW 1 39333912 missense possibly damaging 0.68
R1844:Npas2 UTSW 1 39325375 missense probably damaging 1.00
R1868:Npas2 UTSW 1 39300678 missense probably benign 0.03
R1892:Npas2 UTSW 1 39345422 missense probably benign 0.00
R2002:Npas2 UTSW 1 39338195 missense probably benign 0.10
R3157:Npas2 UTSW 1 39347609 missense possibly damaging 0.92
R3551:Npas2 UTSW 1 39287562 missense probably benign 0.05
R4564:Npas2 UTSW 1 39287566 missense probably damaging 1.00
R4907:Npas2 UTSW 1 39361985 missense unknown
R5044:Npas2 UTSW 1 39347506 nonsense probably null
R5621:Npas2 UTSW 1 39359713 missense probably benign
R5779:Npas2 UTSW 1 39287571 missense possibly damaging 0.48
R5822:Npas2 UTSW 1 39347566 missense probably benign 0.00
R6033:Npas2 UTSW 1 39338180 missense probably damaging 0.99
R6033:Npas2 UTSW 1 39338180 missense probably damaging 0.99
R6193:Npas2 UTSW 1 39292762 missense probably damaging 1.00
R6220:Npas2 UTSW 1 39336061 missense probably benign 0.00
R6341:Npas2 UTSW 1 39300687 missense probably damaging 0.98
R6656:Npas2 UTSW 1 39361948 missense unknown
R6778:Npas2 UTSW 1 39325300 missense possibly damaging 0.92
R6803:Npas2 UTSW 1 39336049 missense probably benign 0.35
R7165:Npas2 UTSW 1 39292717 missense possibly damaging 0.79
R7250:Npas2 UTSW 1 39338107 missense probably damaging 1.00
R7268:Npas2 UTSW 1 39287577 missense probably damaging 0.98
R7284:Npas2 UTSW 1 39324467 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- TAGCAAAACATGTTTCTTGCCCC -3'
(R):5'- ACTCATCACCTGCAGGAAGG -3'

Sequencing Primer
(F):5'- CCATTACTCAGCTCCAAAATGTG -3'
(R):5'- CATCACCTGCAGGAAGGGTAGG -3'
Posted On2017-10-10