Incidental Mutation 'R6155:Taf4'
ID489502
Institutional Source Beutler Lab
Gene Symbol Taf4
Ensembl Gene ENSMUSG00000039117
Gene NameTATA-box binding protein associated factor 4
SynonymsTaf4a, Taf2c1, TAFII130, TAFII135
MMRRC Submission 044302-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6155 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location179912152-179976646 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 179913524 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1015 (V1015A)
Ref Sequence ENSEMBL: ENSMUSP00000038610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041618] [ENSMUST00000227325]
Predicted Effect probably damaging
Transcript: ENSMUST00000041618
AA Change: V1015A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038610
Gene: ENSMUSG00000039117
AA Change: V1015A

DomainStartEndE-ValueType
low complexity region 28 44 N/A INTRINSIC
low complexity region 64 181 N/A INTRINSIC
SCOP:d1hqva_ 312 325 6e-3 SMART
low complexity region 339 371 N/A INTRINSIC
low complexity region 395 408 N/A INTRINSIC
low complexity region 428 443 N/A INTRINSIC
low complexity region 445 458 N/A INTRINSIC
internal_repeat_1 465 500 2.85e-5 PROSPERO
low complexity region 537 547 N/A INTRINSIC
TAFH 550 642 4.9e-54 SMART
internal_repeat_1 692 727 2.85e-5 PROSPERO
low complexity region 767 773 N/A INTRINSIC
Pfam:TAF4 791 1039 3.5e-81 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000227325
AA Change: V1003A

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Meta Mutation Damage Score 0.382 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes one of the larger subunits of TFIID that has been shown to potentiate transcriptional activation by retinoic acid, thyroid hormone and vitamin D3 receptors. In addition, this subunit interacts with the transcription factor CREB, which has a glutamine-rich activation domain, and binds to other proteins containing glutamine-rich regions. Aberrant binding to this subunit by proteins with expanded polyglutamine regions has been suggested as one of the pathogenetic mechanisms underlying a group of neurodegenerative disorders referred to as polyglutamine diseases. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for deletions of this marker die embryonically sometime around E9.5. Conditional expression of this allele in the epidermis causes skin barrier defects and defects in hair growth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 T C 5: 104,963,644 Y319C probably benign Het
Actn4 A C 7: 28,896,141 I763S probably damaging Het
Actr8 G A 14: 29,978,589 probably null Het
Adrb1 T C 19: 56,722,904 L178P probably damaging Het
Afap1 A G 5: 35,935,609 Y19C unknown Het
Ankrd36 A G 11: 5,687,442 E1337G probably benign Het
Arl4a A C 12: 40,036,520 V76G probably damaging Het
B230118H07Rik A T 2: 101,576,010 probably null Het
Bmp1 A T 14: 70,508,007 I246K probably damaging Het
Camk4 A T 18: 32,939,447 T18S unknown Het
Cep152 T C 2: 125,581,700 H927R probably benign Het
Clca3a2 A G 3: 144,819,357 I38T probably damaging Het
Clec2g A C 6: 128,980,273 T54P probably damaging Het
Cox20 A G 1: 178,321,797 E31G possibly damaging Het
Crispld1 T A 1: 17,753,017 H407Q probably benign Het
Csmd1 T C 8: 15,903,231 I3417V probably benign Het
Dhtkd1 A C 2: 5,910,359 H700Q probably null Het
Dnah10 G A 5: 124,770,599 V1516M probably damaging Het
Dnah10 A G 5: 124,785,175 T2165A probably damaging Het
Dock2 C G 11: 34,294,123 M1072I probably benign Het
F11 T A 8: 45,252,082 T141S probably damaging Het
Gabra6 T A 11: 42,316,523 I245F probably damaging Het
Gm13101 T A 4: 143,965,142 H337L probably benign Het
Gm8909 G A 17: 36,167,507 A211V possibly damaging Het
Herc1 T A 9: 66,433,423 C1685S possibly damaging Het
Il20 G T 1: 130,910,740 D73E probably damaging Het
Ireb2 C A 9: 54,886,527 P247Q probably damaging Het
Kcng3 T C 17: 83,588,378 I220V probably benign Het
Lce1j T G 3: 92,789,072 Q133P unknown Het
Lgals9 C T 11: 78,963,505 A287T probably benign Het
Lrrc52 A G 1: 167,466,727 probably benign Het
Map3k5 A T 10: 20,118,441 H1027L probably benign Het
Morc3 A G 16: 93,862,425 D407G possibly damaging Het
Myom1 T C 17: 71,108,695 probably null Het
Ncapg2 T C 12: 116,438,011 F673S possibly damaging Het
Ncoa6 T C 2: 155,407,448 D1312G probably damaging Het
Nkx1-1 A T 5: 33,431,051 F298I probably damaging Het
Npas2 G A 1: 39,287,476 R14Q probably damaging Het
Npas4 C T 19: 4,986,870 C422Y probably damaging Het
Olfr1230 A G 2: 89,296,421 L283S probably damaging Het
Olfr1381 T A 11: 49,552,584 I279N possibly damaging Het
Olfr481 T C 7: 108,081,286 V164A probably benign Het
Olfr749 T C 14: 50,736,619 D181G probably benign Het
Pcdhga4 T C 18: 37,686,493 I365T probably damaging Het
Pear1 T A 3: 87,759,568 T37S probably damaging Het
Pkn2 A T 3: 142,853,693 F24I probably benign Het
Plcb3 G A 19: 6,966,165 A122V probably damaging Het
Pnliprp1 T C 19: 58,730,133 probably null Het
Psmb3 T A 11: 97,712,452 F164I probably damaging Het
Ptch2 T A 4: 117,096,908 F45Y probably damaging Het
Ptpn23 C A 9: 110,387,781 probably benign Het
Pusl1 A G 4: 155,890,548 S199P probably damaging Het
Rasgrp2 C A 19: 6,402,501 L35I probably damaging Het
Rictor T C 15: 6,793,977 L1545P probably benign Het
Rtn4r A T 16: 18,151,394 M229L probably benign Het
Ruvbl1 A T 6: 88,479,125 probably null Het
Slc35b3 A T 13: 38,944,596 S30T probably damaging Het
Sorcs3 T C 19: 48,398,697 V207A possibly damaging Het
Sox13 A G 1: 133,393,267 S2P probably damaging Het
Sptbn1 A C 11: 30,137,403 L999R probably damaging Het
Top3b T C 16: 16,891,509 L687P probably damaging Het
Tpp2 T A 1: 43,956,489 V268E probably damaging Het
Ttc6 T C 12: 57,737,616 Y1824H possibly damaging Het
Txk A G 5: 72,700,726 Y360H probably damaging Het
Vmn2r57 T C 7: 41,428,690 I115V probably benign Het
Vmn2r98 T C 17: 19,065,881 S214P possibly damaging Het
Zbtb48 T C 4: 152,022,038 probably null Het
Zzz3 A G 3: 152,427,682 I126V possibly damaging Het
Other mutations in Taf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Taf4 APN 2 179976625 missense unknown
IGL00517:Taf4 APN 2 179924413 splice site probably benign
IGL02159:Taf4 APN 2 179938470 missense probably benign 0.24
IGL02254:Taf4 APN 2 179921184 missense probably benign 0.25
IGL03366:Taf4 APN 2 179935054 missense probably damaging 1.00
R0049:Taf4 UTSW 2 179924091 missense probably damaging 0.98
R0049:Taf4 UTSW 2 179924091 missense probably damaging 0.98
R1267:Taf4 UTSW 2 179929324 missense possibly damaging 0.46
R1495:Taf4 UTSW 2 179933027 missense probably damaging 1.00
R1560:Taf4 UTSW 2 179935953 missense probably benign 0.14
R1756:Taf4 UTSW 2 179976531 missense unknown
R1893:Taf4 UTSW 2 179933030 missense probably damaging 0.98
R1932:Taf4 UTSW 2 179932029 missense probably damaging 1.00
R2213:Taf4 UTSW 2 179935890 critical splice donor site probably null
R3896:Taf4 UTSW 2 179932014 missense probably benign 0.45
R4050:Taf4 UTSW 2 179932012 missense probably damaging 1.00
R4448:Taf4 UTSW 2 179935971 missense possibly damaging 0.65
R4736:Taf4 UTSW 2 179924494 missense probably damaging 1.00
R5124:Taf4 UTSW 2 179932029 missense probably damaging 1.00
R6238:Taf4 UTSW 2 179932039 missense probably damaging 0.97
R6292:Taf4 UTSW 2 179923987 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTGCTCCATTGTAAAGAGGTG -3'
(R):5'- AGGGTGTTTCCTCAAAACCAG -3'

Sequencing Primer
(F):5'- TGTAAAGAGGTGGCTGTTTTTAAAC -3'
(R):5'- CTCAAAACCAGGGTCTTTGGGATAC -3'
Posted On2017-10-10