Incidental Mutation 'R6155:Ttc6'
ID489537
Institutional Source Beutler Lab
Gene Symbol Ttc6
Ensembl Gene ENSMUSG00000046782
Gene Nametetratricopeptide repeat domain 6
SynonymsEG639426, LOC217602, Gm9813
MMRRC Submission 044302-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.183) question?
Stock #R6155 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location57564113-57737928 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57737616 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 1824 (Y1824H)
Ref Sequence ENSEMBL: ENSMUSP00000134273 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172939]
Predicted Effect possibly damaging
Transcript: ENSMUST00000172939
AA Change: Y1824H

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000134273
Gene: ENSMUSG00000046782
AA Change: Y1824H

DomainStartEndE-ValueType
coiled coil region 18 42 N/A INTRINSIC
low complexity region 146 162 N/A INTRINSIC
low complexity region 188 212 N/A INTRINSIC
low complexity region 227 238 N/A INTRINSIC
low complexity region 486 495 N/A INTRINSIC
low complexity region 670 685 N/A INTRINSIC
low complexity region 733 740 N/A INTRINSIC
TPR 889 922 2e-4 SMART
TPR 957 989 2.36e1 SMART
TPR 990 1022 2.63e1 SMART
TPR 1023 1056 9.39e-1 SMART
TPR 1057 1090 3.78e-5 SMART
Blast:TPR 1126 1157 1e-11 BLAST
SEL1 1160 1192 3.39e1 SMART
TPR 1160 1194 4.44e1 SMART
TPR 1195 1228 7.87e0 SMART
Blast:TPR 1229 1262 1e-11 BLAST
TPR 1297 1330 1.24e0 SMART
SEL1 1341 1372 9.26e-1 SMART
TPR 1341 1374 3.45e-8 SMART
TPR 1375 1407 8.76e-1 SMART
TPR 1408 1441 1.45e-1 SMART
TPR 1442 1475 1.36e1 SMART
TPR 1476 1509 7.34e-3 SMART
TPR 1513 1546 1.01e0 SMART
TPR 1547 1580 2.55e-2 SMART
TPR 1581 1617 2.43e1 SMART
Blast:TPR 1618 1651 4e-12 BLAST
TPR 1652 1685 7.87e0 SMART
TPR 1686 1718 2.35e-1 SMART
SEL1 1719 1750 1.21e2 SMART
TPR 1719 1752 1.65e-5 SMART
TPR 1753 1786 1.66e-1 SMART
TPR 1787 1820 1.45e-1 SMART
TPR 1821 1854 3.27e0 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 T C 5: 104,963,644 Y319C probably benign Het
Actn4 A C 7: 28,896,141 I763S probably damaging Het
Actr8 G A 14: 29,978,589 probably null Het
Adrb1 T C 19: 56,722,904 L178P probably damaging Het
Afap1 A G 5: 35,935,609 Y19C unknown Het
Ankrd36 A G 11: 5,687,442 E1337G probably benign Het
Arl4a A C 12: 40,036,520 V76G probably damaging Het
B230118H07Rik A T 2: 101,576,010 probably null Het
Bmp1 A T 14: 70,508,007 I246K probably damaging Het
Camk4 A T 18: 32,939,447 T18S unknown Het
Cep152 T C 2: 125,581,700 H927R probably benign Het
Clca3a2 A G 3: 144,819,357 I38T probably damaging Het
Clec2g A C 6: 128,980,273 T54P probably damaging Het
Cox20 A G 1: 178,321,797 E31G possibly damaging Het
Crispld1 T A 1: 17,753,017 H407Q probably benign Het
Csmd1 T C 8: 15,903,231 I3417V probably benign Het
Dhtkd1 A C 2: 5,910,359 H700Q probably null Het
Dnah10 G A 5: 124,770,599 V1516M probably damaging Het
Dnah10 A G 5: 124,785,175 T2165A probably damaging Het
Dock2 C G 11: 34,294,123 M1072I probably benign Het
F11 T A 8: 45,252,082 T141S probably damaging Het
Gabra6 T A 11: 42,316,523 I245F probably damaging Het
Gm13101 T A 4: 143,965,142 H337L probably benign Het
Gm8909 G A 17: 36,167,507 A211V possibly damaging Het
Herc1 T A 9: 66,433,423 C1685S possibly damaging Het
Il20 G T 1: 130,910,740 D73E probably damaging Het
Ireb2 C A 9: 54,886,527 P247Q probably damaging Het
Kcng3 T C 17: 83,588,378 I220V probably benign Het
Lce1j T G 3: 92,789,072 Q133P unknown Het
Lgals9 C T 11: 78,963,505 A287T probably benign Het
Lrrc52 A G 1: 167,466,727 probably benign Het
Map3k5 A T 10: 20,118,441 H1027L probably benign Het
Morc3 A G 16: 93,862,425 D407G possibly damaging Het
Myom1 T C 17: 71,108,695 probably null Het
Ncapg2 T C 12: 116,438,011 F673S possibly damaging Het
Ncoa6 T C 2: 155,407,448 D1312G probably damaging Het
Nkx1-1 A T 5: 33,431,051 F298I probably damaging Het
Npas2 G A 1: 39,287,476 R14Q probably damaging Het
Npas4 C T 19: 4,986,870 C422Y probably damaging Het
Olfr1230 A G 2: 89,296,421 L283S probably damaging Het
Olfr1381 T A 11: 49,552,584 I279N possibly damaging Het
Olfr481 T C 7: 108,081,286 V164A probably benign Het
Olfr749 T C 14: 50,736,619 D181G probably benign Het
Pcdhga4 T C 18: 37,686,493 I365T probably damaging Het
Pear1 T A 3: 87,759,568 T37S probably damaging Het
Pkn2 A T 3: 142,853,693 F24I probably benign Het
Plcb3 G A 19: 6,966,165 A122V probably damaging Het
Pnliprp1 T C 19: 58,730,133 probably null Het
Psmb3 T A 11: 97,712,452 F164I probably damaging Het
Ptch2 T A 4: 117,096,908 F45Y probably damaging Het
Ptpn23 C A 9: 110,387,781 probably benign Het
Pusl1 A G 4: 155,890,548 S199P probably damaging Het
Rasgrp2 C A 19: 6,402,501 L35I probably damaging Het
Rictor T C 15: 6,793,977 L1545P probably benign Het
Rtn4r A T 16: 18,151,394 M229L probably benign Het
Ruvbl1 A T 6: 88,479,125 probably null Het
Slc35b3 A T 13: 38,944,596 S30T probably damaging Het
Sorcs3 T C 19: 48,398,697 V207A possibly damaging Het
Sox13 A G 1: 133,393,267 S2P probably damaging Het
Sptbn1 A C 11: 30,137,403 L999R probably damaging Het
Taf4 A G 2: 179,913,524 V1015A probably damaging Het
Top3b T C 16: 16,891,509 L687P probably damaging Het
Tpp2 T A 1: 43,956,489 V268E probably damaging Het
Txk A G 5: 72,700,726 Y360H probably damaging Het
Vmn2r57 T C 7: 41,428,690 I115V probably benign Het
Vmn2r98 T C 17: 19,065,881 S214P possibly damaging Het
Zbtb48 T C 4: 152,022,038 probably null Het
Zzz3 A G 3: 152,427,682 I126V possibly damaging Het
Other mutations in Ttc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03278:Ttc6 APN 12 57622026 missense probably damaging 0.99
IGL02802:Ttc6 UTSW 12 57575868 missense probably benign 0.14
PIT4802001:Ttc6 UTSW 12 57725676 missense possibly damaging 0.89
R0698:Ttc6 UTSW 12 57673216 missense probably benign 0.04
R0988:Ttc6 UTSW 12 57688649 splice site probably benign
R1290:Ttc6 UTSW 12 57660413 missense probably benign 0.00
R1338:Ttc6 UTSW 12 57616369 missense probably benign 0.10
R1468:Ttc6 UTSW 12 57674677 missense possibly damaging 0.54
R1468:Ttc6 UTSW 12 57674677 missense possibly damaging 0.54
R1481:Ttc6 UTSW 12 57737130 missense probably damaging 1.00
R1488:Ttc6 UTSW 12 57649515 missense possibly damaging 0.66
R1558:Ttc6 UTSW 12 57686346 missense probably benign 0.14
R1570:Ttc6 UTSW 12 57674763 missense probably damaging 0.98
R1619:Ttc6 UTSW 12 57737668 missense possibly damaging 0.73
R1819:Ttc6 UTSW 12 57694500 critical splice donor site probably null
R1826:Ttc6 UTSW 12 57660247 missense probably benign 0.10
R1863:Ttc6 UTSW 12 57714095 missense probably benign 0.04
R1872:Ttc6 UTSW 12 57704552 critical splice donor site probably null
R1887:Ttc6 UTSW 12 57673258 missense probably benign 0.04
R1937:Ttc6 UTSW 12 57616323 missense probably benign 0.02
R2014:Ttc6 UTSW 12 57576217 missense possibly damaging 0.92
R2056:Ttc6 UTSW 12 57737693 missense probably benign 0.08
R2058:Ttc6 UTSW 12 57737693 missense probably benign 0.08
R2059:Ttc6 UTSW 12 57737693 missense probably benign 0.08
R2152:Ttc6 UTSW 12 57705552 missense probably damaging 0.98
R2179:Ttc6 UTSW 12 57673118 missense possibly damaging 0.62
R2275:Ttc6 UTSW 12 57702298 missense probably benign 0.01
R2432:Ttc6 UTSW 12 57622035 missense possibly damaging 0.79
R2474:Ttc6 UTSW 12 57575927 missense probably benign 0.37
R2853:Ttc6 UTSW 12 57576181 missense probably damaging 0.96
R3848:Ttc6 UTSW 12 57677146 missense probably damaging 0.97
R3853:Ttc6 UTSW 12 57728549 missense possibly damaging 0.88
R3950:Ttc6 UTSW 12 57649506 missense probably damaging 0.97
R3953:Ttc6 UTSW 12 57697452 missense probably benign 0.03
R3954:Ttc6 UTSW 12 57697452 missense probably benign 0.03
R3955:Ttc6 UTSW 12 57697452 missense probably benign 0.03
R3957:Ttc6 UTSW 12 57697452 missense probably benign 0.03
R4135:Ttc6 UTSW 12 57632795 intron probably benign
R4387:Ttc6 UTSW 12 57643050 missense probably benign 0.00
R4577:Ttc6 UTSW 12 57576655 missense probably benign 0.22
R4747:Ttc6 UTSW 12 57674692 missense possibly damaging 0.86
R4779:Ttc6 UTSW 12 57729451 missense probably damaging 1.00
R4803:Ttc6 UTSW 12 57728505 missense probably damaging 1.00
R4871:Ttc6 UTSW 12 57702356 missense probably damaging 0.96
R4898:Ttc6 UTSW 12 57660240 missense probably benign 0.00
R4930:Ttc6 UTSW 12 57673823 critical splice donor site probably null
R4946:Ttc6 UTSW 12 57643140 missense probably benign 0.01
R5257:Ttc6 UTSW 12 57702275 missense possibly damaging 0.92
R5303:Ttc6 UTSW 12 57575820 missense possibly damaging 0.90
R5385:Ttc6 UTSW 12 57643035 splice site probably null
R5402:Ttc6 UTSW 12 57737031 nonsense probably null
R5428:Ttc6 UTSW 12 57689834 missense probably null 0.98
R5436:Ttc6 UTSW 12 57674594 splice site probably null
R5646:Ttc6 UTSW 12 57576019 missense probably damaging 0.99
R5697:Ttc6 UTSW 12 57677214 missense probably benign 0.22
R5792:Ttc6 UTSW 12 57673204 missense possibly damaging 0.71
R5808:Ttc6 UTSW 12 57617611 missense possibly damaging 0.84
R5842:Ttc6 UTSW 12 57737016 missense probably damaging 1.00
R5935:Ttc6 UTSW 12 57673804 missense probably damaging 0.98
R6144:Ttc6 UTSW 12 57673100 missense possibly damaging 0.83
R6283:Ttc6 UTSW 12 57702262 missense possibly damaging 0.95
R6371:Ttc6 UTSW 12 57728463 missense possibly damaging 0.89
R6715:Ttc6 UTSW 12 57674770 critical splice donor site probably null
R6738:Ttc6 UTSW 12 57688640 missense probably damaging 0.99
R6795:Ttc6 UTSW 12 57704413 missense probably damaging 0.96
R6959:Ttc6 UTSW 12 57658142 splice site probably null
R7053:Ttc6 UTSW 12 57660532 missense probably benign 0.01
R7125:Ttc6 UTSW 12 57576339 missense probably benign 0.00
R7259:Ttc6 UTSW 12 57576184 missense probably benign 0.00
R7304:Ttc6 UTSW 12 57576051 missense probably damaging 0.96
R7369:Ttc6 UTSW 12 57672931 critical splice acceptor site probably null
X0021:Ttc6 UTSW 12 57576118 missense probably damaging 0.96
X0058:Ttc6 UTSW 12 57706851 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACAGAGTGGTTTCCATAACATCTC -3'
(R):5'- AATGGTGGCATTTCTACACAAC -3'

Sequencing Primer
(F):5'- CCAAGGACTGTACAGTGGTTTTC -3'
(R):5'- CACAACAAATATATTTCAGCTTCAGG -3'
Posted On2017-10-10