Incidental Mutation 'R6155:Slc35b3'
ID489539
Institutional Source Beutler Lab
Gene Symbol Slc35b3
Ensembl Gene ENSMUSG00000021432
Gene Namesolute carrier family 35, member B3
Synonyms4921526O06Rik, PAPST2
MMRRC Submission 044302-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.654) question?
Stock #R6155 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location38932136-38960875 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 38944596 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 30 (S30T)
Ref Sequence ENSEMBL: ENSMUSP00000153485 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021870] [ENSMUST00000167513] [ENSMUST00000224429] [ENSMUST00000224645] [ENSMUST00000225331] [ENSMUST00000225396] [ENSMUST00000225432] [ENSMUST00000225461] [ENSMUST00000225568] [ENSMUST00000225714]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021870
AA Change: S172T

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000021870
Gene: ENSMUSG00000021432
AA Change: S172T

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
Pfam:UAA 92 383 3.5e-95 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167513
AA Change: S128T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126016
Gene: ENSMUSG00000021432
AA Change: S128T

DomainStartEndE-ValueType
Pfam:UAA 49 343 4e-98 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181087
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223619
Predicted Effect probably benign
Transcript: ENSMUST00000224429
Predicted Effect probably benign
Transcript: ENSMUST00000224645
Predicted Effect probably benign
Transcript: ENSMUST00000225331
Predicted Effect probably benign
Transcript: ENSMUST00000225396
Predicted Effect probably damaging
Transcript: ENSMUST00000225432
AA Change: S128T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000225461
Predicted Effect probably damaging
Transcript: ENSMUST00000225568
AA Change: S30T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000225714
Meta Mutation Damage Score 0.286 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the solute carrier family. The encoded protein is involved in the transport of 3-prime phosphoadenosine 5-prime phosphosulfate (PAPS) from the nucleus or the cytosol to the Golgi lumen. This gene has been reported to be expressed preferentially in the human colon tissues. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 T C 5: 104,963,644 Y319C probably benign Het
Actn4 A C 7: 28,896,141 I763S probably damaging Het
Actr8 G A 14: 29,978,589 probably null Het
Adrb1 T C 19: 56,722,904 L178P probably damaging Het
Afap1 A G 5: 35,935,609 Y19C unknown Het
Ankrd36 A G 11: 5,687,442 E1337G probably benign Het
Arl4a A C 12: 40,036,520 V76G probably damaging Het
B230118H07Rik A T 2: 101,576,010 probably null Het
Bmp1 A T 14: 70,508,007 I246K probably damaging Het
Camk4 A T 18: 32,939,447 T18S unknown Het
Cep152 T C 2: 125,581,700 H927R probably benign Het
Clca3a2 A G 3: 144,819,357 I38T probably damaging Het
Clec2g A C 6: 128,980,273 T54P probably damaging Het
Cox20 A G 1: 178,321,797 E31G possibly damaging Het
Crispld1 T A 1: 17,753,017 H407Q probably benign Het
Csmd1 T C 8: 15,903,231 I3417V probably benign Het
Dhtkd1 A C 2: 5,910,359 H700Q probably null Het
Dnah10 G A 5: 124,770,599 V1516M probably damaging Het
Dnah10 A G 5: 124,785,175 T2165A probably damaging Het
Dock2 C G 11: 34,294,123 M1072I probably benign Het
F11 T A 8: 45,252,082 T141S probably damaging Het
Gabra6 T A 11: 42,316,523 I245F probably damaging Het
Gm13101 T A 4: 143,965,142 H337L probably benign Het
Gm8909 G A 17: 36,167,507 A211V possibly damaging Het
Herc1 T A 9: 66,433,423 C1685S possibly damaging Het
Il20 G T 1: 130,910,740 D73E probably damaging Het
Ireb2 C A 9: 54,886,527 P247Q probably damaging Het
Kcng3 T C 17: 83,588,378 I220V probably benign Het
Lce1j T G 3: 92,789,072 Q133P unknown Het
Lgals9 C T 11: 78,963,505 A287T probably benign Het
Lrrc52 A G 1: 167,466,727 probably benign Het
Map3k5 A T 10: 20,118,441 H1027L probably benign Het
Morc3 A G 16: 93,862,425 D407G possibly damaging Het
Myom1 T C 17: 71,108,695 probably null Het
Ncapg2 T C 12: 116,438,011 F673S possibly damaging Het
Ncoa6 T C 2: 155,407,448 D1312G probably damaging Het
Nkx1-1 A T 5: 33,431,051 F298I probably damaging Het
Npas2 G A 1: 39,287,476 R14Q probably damaging Het
Npas4 C T 19: 4,986,870 C422Y probably damaging Het
Olfr1230 A G 2: 89,296,421 L283S probably damaging Het
Olfr1381 T A 11: 49,552,584 I279N possibly damaging Het
Olfr481 T C 7: 108,081,286 V164A probably benign Het
Olfr749 T C 14: 50,736,619 D181G probably benign Het
Pcdhga4 T C 18: 37,686,493 I365T probably damaging Het
Pear1 T A 3: 87,759,568 T37S probably damaging Het
Pkn2 A T 3: 142,853,693 F24I probably benign Het
Plcb3 G A 19: 6,966,165 A122V probably damaging Het
Pnliprp1 T C 19: 58,730,133 probably null Het
Psmb3 T A 11: 97,712,452 F164I probably damaging Het
Ptch2 T A 4: 117,096,908 F45Y probably damaging Het
Ptpn23 C A 9: 110,387,781 probably benign Het
Pusl1 A G 4: 155,890,548 S199P probably damaging Het
Rasgrp2 C A 19: 6,402,501 L35I probably damaging Het
Rictor T C 15: 6,793,977 L1545P probably benign Het
Rtn4r A T 16: 18,151,394 M229L probably benign Het
Ruvbl1 A T 6: 88,479,125 probably null Het
Sorcs3 T C 19: 48,398,697 V207A possibly damaging Het
Sox13 A G 1: 133,393,267 S2P probably damaging Het
Sptbn1 A C 11: 30,137,403 L999R probably damaging Het
Taf4 A G 2: 179,913,524 V1015A probably damaging Het
Top3b T C 16: 16,891,509 L687P probably damaging Het
Tpp2 T A 1: 43,956,489 V268E probably damaging Het
Ttc6 T C 12: 57,737,616 Y1824H possibly damaging Het
Txk A G 5: 72,700,726 Y360H probably damaging Het
Vmn2r57 T C 7: 41,428,690 I115V probably benign Het
Vmn2r98 T C 17: 19,065,881 S214P possibly damaging Het
Zbtb48 T C 4: 152,022,038 probably null Het
Zzz3 A G 3: 152,427,682 I126V possibly damaging Het
Other mutations in Slc35b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00782:Slc35b3 APN 13 38943140 missense possibly damaging 0.82
IGL02111:Slc35b3 APN 13 38955782 missense probably damaging 0.99
R0883:Slc35b3 UTSW 13 38937275 missense probably benign 0.09
R1170:Slc35b3 UTSW 13 38937331 missense probably benign 0.03
R1440:Slc35b3 UTSW 13 38954134 nonsense probably null
R1653:Slc35b3 UTSW 13 38955798 missense probably benign 0.02
R1900:Slc35b3 UTSW 13 38960611 critical splice donor site probably null
R3874:Slc35b3 UTSW 13 38943068 missense possibly damaging 0.66
R3897:Slc35b3 UTSW 13 38934763 missense probably benign 0.09
R4399:Slc35b3 UTSW 13 38937815 missense possibly damaging 0.95
R4937:Slc35b3 UTSW 13 38932911 missense possibly damaging 0.89
R4955:Slc35b3 UTSW 13 38932890 missense probably benign 0.08
R5034:Slc35b3 UTSW 13 38943158 missense probably damaging 1.00
R5770:Slc35b3 UTSW 13 38937758 missense probably damaging 0.98
R6663:Slc35b3 UTSW 13 38954136 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAACTCAGTTGTGGACATTTGATTG -3'
(R):5'- TGTACCGATAAGCAGTGTTACAAC -3'

Sequencing Primer
(F):5'- GATTGTTTTTCCTAATGCCAGATGC -3'
(R):5'- TGACATTTTAAACGTATGCTTCCAG -3'
Posted On2017-10-10