Incidental Mutation 'R6155:Bmp1'
ID489542
Institutional Source Beutler Lab
Gene Symbol Bmp1
Ensembl Gene ENSMUSG00000022098
Gene Namebone morphogenetic protein 1
Synonyms
MMRRC Submission 044302-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6155 (G1)
Quality Score214.009
Status Not validated
Chromosome14
Chromosomal Location70474558-70520234 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 70508007 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 246 (I246K)
Ref Sequence ENSEMBL: ENSMUSP00000022693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022693] [ENSMUST00000226246] [ENSMUST00000226906] [ENSMUST00000227944]
Predicted Effect probably damaging
Transcript: ENSMUST00000022693
AA Change: I246K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022693
Gene: ENSMUSG00000022098
AA Change: I246K

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
ZnMc 131 273 1.32e-54 SMART
CUB 327 439 4.35e-43 SMART
CUB 440 552 7.86e-50 SMART
EGF_CA 552 593 5.03e-11 SMART
CUB 596 708 1.13e-50 SMART
EGF_CA 708 748 4.81e-8 SMART
CUB 752 864 3.99e-51 SMART
CUB 865 981 7.35e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226246
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226539
Predicted Effect probably benign
Transcript: ENSMUST00000226906
Predicted Effect probably benign
Transcript: ENSMUST00000227944
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a metalloproteinase that plays an essential role in the formation of the extracellular matrix and is also able to induce ectopic bone formation. Unlike other bone morphogenetic proteins, the protein encoded by this gene is not closely related to transforming growth factor-beta. This protein plays in role several developmental processes. In humans, mutations in this gene are associated with osteogenesis imperfecta and with increased bone mineral density and multiple recurrent fractures. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygous targeted mutant embryos have reduced ossification of the skull, persistent herniation of the gut, abnormal collagen fibrils in the amnion, and die at birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 T C 5: 104,963,644 Y319C probably benign Het
Actn4 A C 7: 28,896,141 I763S probably damaging Het
Actr8 G A 14: 29,978,589 probably null Het
Adrb1 T C 19: 56,722,904 L178P probably damaging Het
Afap1 A G 5: 35,935,609 Y19C unknown Het
Ankrd36 A G 11: 5,687,442 E1337G probably benign Het
Arl4a A C 12: 40,036,520 V76G probably damaging Het
B230118H07Rik A T 2: 101,576,010 probably null Het
Camk4 A T 18: 32,939,447 T18S unknown Het
Cep152 T C 2: 125,581,700 H927R probably benign Het
Clca3a2 A G 3: 144,819,357 I38T probably damaging Het
Clec2g A C 6: 128,980,273 T54P probably damaging Het
Cox20 A G 1: 178,321,797 E31G possibly damaging Het
Crispld1 T A 1: 17,753,017 H407Q probably benign Het
Csmd1 T C 8: 15,903,231 I3417V probably benign Het
Dhtkd1 A C 2: 5,910,359 H700Q probably null Het
Dnah10 G A 5: 124,770,599 V1516M probably damaging Het
Dnah10 A G 5: 124,785,175 T2165A probably damaging Het
Dock2 C G 11: 34,294,123 M1072I probably benign Het
F11 T A 8: 45,252,082 T141S probably damaging Het
Gabra6 T A 11: 42,316,523 I245F probably damaging Het
Gm13101 T A 4: 143,965,142 H337L probably benign Het
Gm8909 G A 17: 36,167,507 A211V possibly damaging Het
Herc1 T A 9: 66,433,423 C1685S possibly damaging Het
Il20 G T 1: 130,910,740 D73E probably damaging Het
Ireb2 C A 9: 54,886,527 P247Q probably damaging Het
Kcng3 T C 17: 83,588,378 I220V probably benign Het
Lce1j T G 3: 92,789,072 Q133P unknown Het
Lgals9 C T 11: 78,963,505 A287T probably benign Het
Lrrc52 A G 1: 167,466,727 probably benign Het
Map3k5 A T 10: 20,118,441 H1027L probably benign Het
Morc3 A G 16: 93,862,425 D407G possibly damaging Het
Myom1 T C 17: 71,108,695 probably null Het
Ncapg2 T C 12: 116,438,011 F673S possibly damaging Het
Ncoa6 T C 2: 155,407,448 D1312G probably damaging Het
Nkx1-1 A T 5: 33,431,051 F298I probably damaging Het
Npas2 G A 1: 39,287,476 R14Q probably damaging Het
Npas4 C T 19: 4,986,870 C422Y probably damaging Het
Olfr1230 A G 2: 89,296,421 L283S probably damaging Het
Olfr1381 T A 11: 49,552,584 I279N possibly damaging Het
Olfr481 T C 7: 108,081,286 V164A probably benign Het
Olfr749 T C 14: 50,736,619 D181G probably benign Het
Pcdhga4 T C 18: 37,686,493 I365T probably damaging Het
Pear1 T A 3: 87,759,568 T37S probably damaging Het
Pkn2 A T 3: 142,853,693 F24I probably benign Het
Plcb3 G A 19: 6,966,165 A122V probably damaging Het
Pnliprp1 T C 19: 58,730,133 probably null Het
Psmb3 T A 11: 97,712,452 F164I probably damaging Het
Ptch2 T A 4: 117,096,908 F45Y probably damaging Het
Ptpn23 C A 9: 110,387,781 probably benign Het
Pusl1 A G 4: 155,890,548 S199P probably damaging Het
Rasgrp2 C A 19: 6,402,501 L35I probably damaging Het
Rictor T C 15: 6,793,977 L1545P probably benign Het
Rtn4r A T 16: 18,151,394 M229L probably benign Het
Ruvbl1 A T 6: 88,479,125 probably null Het
Slc35b3 A T 13: 38,944,596 S30T probably damaging Het
Sorcs3 T C 19: 48,398,697 V207A possibly damaging Het
Sox13 A G 1: 133,393,267 S2P probably damaging Het
Sptbn1 A C 11: 30,137,403 L999R probably damaging Het
Taf4 A G 2: 179,913,524 V1015A probably damaging Het
Top3b T C 16: 16,891,509 L687P probably damaging Het
Tpp2 T A 1: 43,956,489 V268E probably damaging Het
Ttc6 T C 12: 57,737,616 Y1824H possibly damaging Het
Txk A G 5: 72,700,726 Y360H probably damaging Het
Vmn2r57 T C 7: 41,428,690 I115V probably benign Het
Vmn2r98 T C 17: 19,065,881 S214P possibly damaging Het
Zbtb48 T C 4: 152,022,038 probably null Het
Zzz3 A G 3: 152,427,682 I126V possibly damaging Het
Other mutations in Bmp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01637:Bmp1 APN 14 70492461 missense probably damaging 1.00
IGL02065:Bmp1 APN 14 70486220 missense probably damaging 0.97
IGL02065:Bmp1 APN 14 70490107 missense probably damaging 0.99
IGL02349:Bmp1 APN 14 70507549 missense possibly damaging 0.61
IGL02486:Bmp1 APN 14 70504776 missense possibly damaging 0.48
PIT4519001:Bmp1 UTSW 14 70490029 missense possibly damaging 0.65
R0394:Bmp1 UTSW 14 70490034 missense probably damaging 0.99
R1371:Bmp1 UTSW 14 70492466 missense probably damaging 1.00
R1604:Bmp1 UTSW 14 70508004 missense possibly damaging 0.66
R1732:Bmp1 UTSW 14 70486265 missense possibly damaging 0.67
R1834:Bmp1 UTSW 14 70508831 missense possibly damaging 0.73
R2008:Bmp1 UTSW 14 70492466 missense probably damaging 1.00
R2197:Bmp1 UTSW 14 70486272 missense possibly damaging 0.83
R3157:Bmp1 UTSW 14 70492107 missense possibly damaging 0.63
R4397:Bmp1 UTSW 14 70490542 splice site probably null
R4609:Bmp1 UTSW 14 70477966 missense probably benign 0.00
R4613:Bmp1 UTSW 14 70508523 missense probably damaging 1.00
R4675:Bmp1 UTSW 14 70492844 missense probably damaging 0.99
R4796:Bmp1 UTSW 14 70492073 splice site probably null
R4884:Bmp1 UTSW 14 70475215 missense probably benign 0.01
R4905:Bmp1 UTSW 14 70491362 missense probably benign 0.06
R5088:Bmp1 UTSW 14 70486219 missense possibly damaging 0.84
R5225:Bmp1 UTSW 14 70480165 missense probably damaging 0.97
R5271:Bmp1 UTSW 14 70508128 missense probably benign 0.34
R5625:Bmp1 UTSW 14 70486166 missense probably benign 0.19
R5653:Bmp1 UTSW 14 70490094 missense probably benign 0.00
R6295:Bmp1 UTSW 14 70491383 missense possibly damaging 0.88
R6618:Bmp1 UTSW 14 70491368 missense probably damaging 1.00
R6649:Bmp1 UTSW 14 70490618 missense probably damaging 1.00
R6653:Bmp1 UTSW 14 70490618 missense probably damaging 1.00
R6951:Bmp1 UTSW 14 70508858 missense probably benign 0.26
R6983:Bmp1 UTSW 14 70508207 missense probably damaging 0.96
R7207:Bmp1 UTSW 14 70479560 missense possibly damaging 0.56
X0028:Bmp1 UTSW 14 70508537 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAGCCTGTGGGGATATCCAG -3'
(R):5'- TGATATGGCTCAGACCCTGG -3'

Sequencing Primer
(F):5'- CAGGGACAAGCTGACTGTAGTCC -3'
(R):5'- GCAAAAAGCCTGCGCATTG -3'
Posted On2017-10-10