Incidental Mutation 'R0526:Fbxo38'
ID48960
Institutional Source Beutler Lab
Gene Symbol Fbxo38
Ensembl Gene ENSMUSG00000042211
Gene NameF-box protein 38
Synonyms6030410I24Rik, SP329
MMRRC Submission 038719-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0526 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location62504069-62548743 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 62505980 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 1084 (Y1084H)
Ref Sequence ENSEMBL: ENSMUSP00000047541 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048688]
Predicted Effect probably damaging
Transcript: ENSMUST00000048688
AA Change: Y1084H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047541
Gene: ENSMUSG00000042211
AA Change: Y1084H

DomainStartEndE-ValueType
Pfam:F-box 29 66 2.6e-5 PFAM
SCOP:d1fqva2 127 357 6e-4 SMART
low complexity region 493 525 N/A INTRINSIC
low complexity region 598 610 N/A INTRINSIC
low complexity region 705 728 N/A INTRINSIC
low complexity region 736 753 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 92.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik A T 4: 137,455,224 N230I possibly damaging Het
4933427D14Rik G T 11: 72,169,783 Q687K probably damaging Het
Actrt2 A G 4: 154,667,412 L89P probably damaging Het
Adamts1 A C 16: 85,802,372 S113R probably benign Het
Agxt2 G T 15: 10,373,862 C118F probably damaging Het
Akap8 G A 17: 32,317,292 T49I probably benign Het
Alk A T 17: 71,869,753 W1519R probably damaging Het
Atf7ip T A 6: 136,559,805 F12Y probably damaging Het
Atp13a5 A G 16: 29,348,740 C131R probably damaging Het
Atp8b4 A G 2: 126,427,363 L168P probably damaging Het
Blm G T 7: 80,505,893 S346* probably null Het
Ccnt2 T G 1: 127,799,445 C199G probably damaging Het
Cd151 A T 7: 141,470,591 H219L probably damaging Het
Cd200r2 A T 16: 44,915,047 R248S probably damaging Het
Cdh3 A G 8: 106,555,446 D822G possibly damaging Het
Clec4b1 T C 6: 123,069,770 probably null Het
Cluh C A 11: 74,665,986 L951I probably benign Het
Cog7 A T 7: 121,963,271 probably null Het
Col25a1 C A 3: 130,476,394 P197Q probably damaging Het
Csde1 T A 3: 103,056,426 S636R possibly damaging Het
Ect2l C A 10: 18,199,940 C66F possibly damaging Het
Elac2 T C 11: 64,999,436 M671T probably benign Het
Evi5 T C 5: 107,821,748 N143S probably benign Het
Ext2 A G 2: 93,806,085 V228A probably damaging Het
Fcgr4 T A 1: 171,029,191 L209Q probably damaging Het
Fgd3 C T 13: 49,296,524 S83N probably benign Het
Gigyf2 T A 1: 87,421,493 M664K probably benign Het
Gm38394 T C 1: 133,658,734 I288M probably damaging Het
Il27ra A T 8: 84,039,499 S219T probably benign Het
Kif15 T C 9: 122,997,797 V800A probably damaging Het
Lmo7 T A 14: 101,900,560 D666E probably damaging Het
Lrp5 T C 19: 3,628,295 D520G probably damaging Het
Lrriq3 T A 3: 155,188,297 M545K probably benign Het
Lsm5 T A 6: 56,703,325 D44V probably damaging Het
Man1c1 G T 4: 134,569,068 Y430* probably null Het
Map4 T A 9: 110,037,278 probably null Het
Megf6 A G 4: 154,258,941 K561R probably benign Het
Myo1e T C 9: 70,322,398 Y173H probably damaging Het
Myo6 T A 9: 80,283,541 S791R possibly damaging Het
Nol11 C A 11: 107,184,771 E144* probably null Het
Ntng2 C T 2: 29,197,062 R416Q probably damaging Het
Nxpe3 T A 16: 55,866,517 I43F possibly damaging Het
Olfr1093 A T 2: 86,786,347 T206S possibly damaging Het
Olfr1284 T A 2: 111,379,492 V164E possibly damaging Het
Pkd1l2 T C 8: 117,082,260 I64V probably damaging Het
Prf1 G A 10: 61,300,254 R103H probably benign Het
Rest A G 5: 77,281,027 D431G probably damaging Het
Serpina10 A T 12: 103,616,868 L439Q probably damaging Het
Sgk3 T G 1: 9,881,579 V176G probably damaging Het
Slc19a3 A G 1: 83,022,733 S188P probably damaging Het
Sorbs1 A G 19: 40,349,948 I336T probably damaging Het
Ssfa2 A G 2: 79,657,346 D591G probably benign Het
Strip1 C T 3: 107,620,039 probably null Het
Syt4 T C 18: 31,443,746 E185G possibly damaging Het
Tcaf3 T A 6: 42,589,804 I784F probably damaging Het
Tgfbr3l G T 8: 4,249,439 R74L possibly damaging Het
Thoc7 A G 14: 13,949,282 M194T probably benign Het
Thsd7b T C 1: 129,951,392 Y989H probably damaging Het
Tmem156 C T 5: 65,075,818 V134I probably benign Het
Tnks A T 8: 34,853,303 V738E probably benign Het
Trpm6 A T 19: 18,792,876 I342F probably damaging Het
Vmn2r69 A T 7: 85,411,503 V291D probably damaging Het
Wdr59 GGGTGGTG GGGTG 8: 111,480,540 probably benign Het
Wnk1 T C 6: 119,951,992 T1292A probably damaging Het
Yes1 T A 5: 32,655,240 C285S probably benign Het
Zbtb49 T C 5: 38,213,919 N206S probably benign Het
Other mutations in Fbxo38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Fbxo38 APN 18 62530800 missense possibly damaging 0.59
IGL01384:Fbxo38 APN 18 62522416 missense probably damaging 0.98
IGL01443:Fbxo38 APN 18 62533670 missense probably damaging 1.00
IGL01515:Fbxo38 APN 18 62518571 missense probably benign 0.00
IGL01621:Fbxo38 APN 18 62522524 splice site probably benign
IGL01975:Fbxo38 APN 18 62515413 missense probably damaging 1.00
IGL02148:Fbxo38 APN 18 62536227 missense probably benign 0.02
IGL02390:Fbxo38 APN 18 62533589 missense probably damaging 1.00
IGL03040:Fbxo38 APN 18 62527252 missense probably damaging 1.00
IGL03088:Fbxo38 APN 18 62522472 missense possibly damaging 0.86
IGL03290:Fbxo38 APN 18 62526163 missense probably benign 0.08
FR4976:Fbxo38 UTSW 18 62515347 small deletion probably benign
R0529:Fbxo38 UTSW 18 62505986 missense probably damaging 1.00
R0789:Fbxo38 UTSW 18 62515499 missense possibly damaging 0.84
R1232:Fbxo38 UTSW 18 62510811 missense probably damaging 1.00
R1857:Fbxo38 UTSW 18 62515418 missense probably damaging 1.00
R1859:Fbxo38 UTSW 18 62515418 missense probably damaging 1.00
R1872:Fbxo38 UTSW 18 62517023 missense probably benign 0.01
R2114:Fbxo38 UTSW 18 62506640 missense possibly damaging 0.71
R2910:Fbxo38 UTSW 18 62519807 missense probably benign 0.01
R2911:Fbxo38 UTSW 18 62519807 missense probably benign 0.01
R3406:Fbxo38 UTSW 18 62514843 missense probably damaging 0.99
R3731:Fbxo38 UTSW 18 62515328 small deletion probably benign
R3792:Fbxo38 UTSW 18 62533462 intron probably null
R3848:Fbxo38 UTSW 18 62515073 missense possibly damaging 0.87
R3948:Fbxo38 UTSW 18 62529544 splice site probably benign
R4151:Fbxo38 UTSW 18 62515328 small deletion probably benign
R4323:Fbxo38 UTSW 18 62515161 missense probably benign
R4456:Fbxo38 UTSW 18 62526249 missense probably damaging 1.00
R4786:Fbxo38 UTSW 18 62529674 missense probably damaging 1.00
R4829:Fbxo38 UTSW 18 62518591 missense probably benign
R4959:Fbxo38 UTSW 18 62522507 missense probably benign 0.45
R5274:Fbxo38 UTSW 18 62515069 missense probably damaging 0.98
R5288:Fbxo38 UTSW 18 62540971 missense probably benign
R5384:Fbxo38 UTSW 18 62540971 missense probably benign
R5385:Fbxo38 UTSW 18 62540971 missense probably benign
R5448:Fbxo38 UTSW 18 62522457 missense possibly damaging 0.59
R5540:Fbxo38 UTSW 18 62514793 critical splice donor site probably null
R5588:Fbxo38 UTSW 18 62526177 missense probably damaging 1.00
R5617:Fbxo38 UTSW 18 62505971 missense probably damaging 1.00
R5636:Fbxo38 UTSW 18 62511018 missense possibly damaging 0.80
R5769:Fbxo38 UTSW 18 62514965 missense probably benign 0.10
R6254:Fbxo38 UTSW 18 62505500 synonymous probably null
R6315:Fbxo38 UTSW 18 62536147 nonsense probably null
R6517:Fbxo38 UTSW 18 62533563 missense probably damaging 1.00
R6673:Fbxo38 UTSW 18 62533915 missense probably damaging 1.00
R6974:Fbxo38 UTSW 18 62506669 missense possibly damaging 0.95
R7022:Fbxo38 UTSW 18 62536224 missense probably damaging 1.00
R7175:Fbxo38 UTSW 18 62515473 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- GTCAGCGGCCTTCAAAGTCATTTC -3'
(R):5'- TCAGGAGAGTCTAAGCCCACACAG -3'

Sequencing Primer
(F):5'- CTTCTGTGTGTCAACAGATACTGAG -3'
(R):5'- TTGCCTCCAGAGAGCTCATT -3'
Posted On2013-06-12