Incidental Mutation 'R6158:Myo18b'
ID489693
Institutional Source Beutler Lab
Gene Symbol Myo18b
Ensembl Gene ENSMUSG00000072720
Gene Namemyosin XVIIIb
Synonyms4932408L24Rik, 4933411E19Rik
MMRRC Submission 044305-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6158 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location112688876-112896362 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 112874172 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 451 (N451K)
Ref Sequence ENSEMBL: ENSMUSP00000083810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086617]
Predicted Effect probably benign
Transcript: ENSMUST00000086617
AA Change: N451K

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000083810
Gene: ENSMUSG00000072720
AA Change: N451K

DomainStartEndE-ValueType
low complexity region 20 28 N/A INTRINSIC
low complexity region 43 59 N/A INTRINSIC
low complexity region 86 100 N/A INTRINSIC
low complexity region 185 200 N/A INTRINSIC
low complexity region 273 290 N/A INTRINSIC
low complexity region 291 304 N/A INTRINSIC
low complexity region 355 372 N/A INTRINSIC
low complexity region 377 419 N/A INTRINSIC
MYSc 605 1374 8.78e-30 SMART
IQ 1375 1397 5.92e-4 SMART
Pfam:Myosin_tail_1 1423 1875 5e-12 PFAM
low complexity region 1965 1985 N/A INTRINSIC
coiled coil region 2052 2126 N/A INTRINSIC
low complexity region 2184 2199 N/A INTRINSIC
low complexity region 2325 2336 N/A INTRINSIC
low complexity region 2408 2424 N/A INTRINSIC
low complexity region 2544 2558 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183029
Predicted Effect probably benign
Transcript: ENSMUST00000183273
Meta Mutation Damage Score 0.042 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.5%
  • 20x: 92.6%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may regulate muscle-specific genes when in the nucleus and may influence intracellular trafficking when in the cytoplasm. The encoded protein functions as a homodimer and may interact with F actin. Mutations in this gene are associated with lung cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis with internal hemorrhage, pericaridal effusion, enlargement of the right atrium, and cardiac myofibril abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T C 12: 71,170,636 V793A possibly damaging Het
2900092C05Rik A G 7: 12,512,672 T32A probably benign Het
Adprhl1 C T 8: 13,224,977 V594M possibly damaging Het
Ano3 A T 2: 110,665,875 Y845N probably damaging Het
Arhgap24 A T 5: 102,892,912 I575L probably benign Het
Aurka A C 2: 172,363,596 probably null Het
C1qtnf5 A T 9: 44,108,970 probably benign Het
Cacnb2 A G 2: 14,985,601 D454G possibly damaging Het
Ccdc58 T A 16: 36,089,929 V118D probably damaging Het
Chchd5 T C 2: 129,130,517 L87P probably damaging Het
Col7a1 G T 9: 108,964,603 R1377L unknown Het
Cpne8 A C 15: 90,571,988 S191A probably damaging Het
Dhx30 A T 9: 110,087,030 I671N probably damaging Het
Dnah12 A T 14: 26,773,685 K1423N possibly damaging Het
Dnm3 T C 1: 162,320,987 M272V probably damaging Het
Fat4 A T 3: 38,983,262 S3688C possibly damaging Het
Frmpd1 A T 4: 45,285,401 L1407F probably damaging Het
Fry T C 5: 150,454,572 S410P probably damaging Het
Gm11565 T A 11: 99,914,918 C45* probably null Het
Gngt1 A T 6: 3,994,311 R30* probably null Het
Htt T C 5: 34,907,086 I2943T possibly damaging Het
Kl T A 5: 150,988,853 M689K possibly damaging Het
Lmo7 T A 14: 101,900,137 D247E probably benign Het
Mastl G T 2: 23,132,772 N646K possibly damaging Het
Mei4 G T 9: 81,927,576 L237F probably damaging Het
Mettl27 C T 5: 134,940,576 P170S possibly damaging Het
Mgam T A 6: 40,757,714 I896K probably damaging Het
Moxd1 T A 10: 24,284,777 C443S probably damaging Het
Myo7b T C 18: 31,988,549 I768V probably benign Het
Nos1 A C 5: 117,867,574 I120L probably benign Het
Nsd1 T C 13: 55,245,621 V345A probably benign Het
Olfr1095 A G 2: 86,851,515 L61P possibly damaging Het
Olfr1205 T C 2: 88,831,146 F10L probably damaging Het
Olfr150 C T 9: 39,737,076 T87I probably benign Het
Olfr170 C A 16: 19,605,925 V248F probably damaging Het
Olfr344 A T 2: 36,569,116 T173S probably benign Het
Pdzph1 T G 17: 58,973,627 Q553H probably damaging Het
Piwil1 T A 5: 128,747,876 L546* probably null Het
Pla2g4f T C 2: 120,301,071 T724A probably benign Het
Ralgapa2 A T 2: 146,424,676 M660K possibly damaging Het
Rgsl1 T C 1: 153,804,021 D103G possibly damaging Het
Rnf186 A G 4: 138,967,254 D35G probably damaging Het
Rock2 A G 12: 16,954,918 D424G probably benign Het
Scg2 A T 1: 79,435,400 D495E probably damaging Het
Slc39a2 G A 14: 51,894,224 probably null Het
Snrnp48 T A 13: 38,210,236 Y100* probably null Het
Spaca1 A G 4: 34,029,176 M99T probably damaging Het
Specc1 T G 11: 62,118,124 F235L probably damaging Het
St13 A T 15: 81,399,601 probably null Het
Swap70 T A 7: 110,270,023 M341K probably damaging Het
Synj2 A G 17: 5,986,212 D67G probably benign Het
Tmem135 T A 7: 89,156,444 I251F probably benign Het
Tmem87a A T 2: 120,360,103 probably null Het
Tom1l2 C T 11: 60,232,927 D128N probably damaging Het
Tpx2 C A 2: 152,873,104 H82N probably benign Het
Trip12 A T 1: 84,761,012 C738S possibly damaging Het
Ttyh1 A G 7: 4,125,562 T153A probably benign Het
Utrn C T 10: 12,690,822 G1199S probably benign Het
Vmn1r8 T A 6: 57,036,289 N108K probably benign Het
Vmn2r63 T A 7: 42,933,680 D37V probably damaging Het
Vwce C T 19: 10,644,221 R206C possibly damaging Het
Wrn G T 8: 33,319,172 F265L probably damaging Het
Zfp472 T A 17: 32,978,389 C479* probably null Het
Zfp831 A T 2: 174,643,858 T109S possibly damaging Het
Znfx1 G T 2: 167,056,726 Q93K probably benign Het
Other mutations in Myo18b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Myo18b APN 5 112874131 missense probably benign 0.05
IGL00847:Myo18b APN 5 112830389 splice site probably benign
IGL00848:Myo18b APN 5 112871485 missense probably damaging 1.00
IGL00969:Myo18b APN 5 112875007 unclassified probably benign
IGL01018:Myo18b APN 5 112809747 missense probably damaging 1.00
IGL01448:Myo18b APN 5 112811704 missense probably damaging 1.00
IGL01490:Myo18b APN 5 112809700 missense possibly damaging 0.84
IGL01556:Myo18b APN 5 112757449 splice site probably benign
IGL01637:Myo18b APN 5 112840629 missense possibly damaging 0.82
IGL01819:Myo18b APN 5 112878050 missense unknown
IGL02007:Myo18b APN 5 112874972 unclassified probably benign
IGL02146:Myo18b APN 5 112843285 missense probably damaging 1.00
IGL02229:Myo18b APN 5 112878110 missense unknown
IGL02319:Myo18b APN 5 112791139 missense probably damaging 0.99
IGL02398:Myo18b APN 5 112830312 missense possibly damaging 0.92
IGL02420:Myo18b APN 5 112827986 missense possibly damaging 0.64
IGL02626:Myo18b APN 5 112878085 missense unknown
IGL02815:Myo18b APN 5 112809735 missense probably damaging 1.00
IGL02822:Myo18b APN 5 112775345 missense probably damaging 1.00
IGL02852:Myo18b APN 5 112715511 missense probably benign 0.03
IGL02995:Myo18b APN 5 112775413 splice site probably benign
IGL03019:Myo18b APN 5 112692397 missense probably benign 0.21
IGL03039:Myo18b APN 5 112840771 missense probably damaging 1.00
IGL03112:Myo18b APN 5 112873990 missense probably benign 0.02
IGL03123:Myo18b APN 5 112874938 unclassified probably benign
IGL03288:Myo18b APN 5 112789997 missense probably damaging 1.00
IGL03391:Myo18b APN 5 112874479 unclassified probably benign
PIT4651001:Myo18b UTSW 5 112834435 missense probably benign 0.01
R0271:Myo18b UTSW 5 112809685 missense possibly damaging 0.91
R0277:Myo18b UTSW 5 112693347 splice site probably benign
R0352:Myo18b UTSW 5 112874523 unclassified probably benign
R0504:Myo18b UTSW 5 112873576 unclassified probably benign
R0539:Myo18b UTSW 5 112723868 missense probably damaging 0.99
R0599:Myo18b UTSW 5 112865750 missense probably damaging 1.00
R0627:Myo18b UTSW 5 112798834 missense probably benign 0.38
R0659:Myo18b UTSW 5 112760327 missense possibly damaging 0.66
R0671:Myo18b UTSW 5 112692766 missense probably benign 0.00
R0847:Myo18b UTSW 5 112874488 unclassified probably benign
R1082:Myo18b UTSW 5 112760414 missense probably damaging 1.00
R1116:Myo18b UTSW 5 112803279 missense probably damaging 1.00
R1264:Myo18b UTSW 5 112830319 missense probably benign 0.12
R1280:Myo18b UTSW 5 112723805 critical splice donor site probably null
R1444:Myo18b UTSW 5 112775251 critical splice donor site probably null
R1446:Myo18b UTSW 5 112757559 missense probably damaging 1.00
R1470:Myo18b UTSW 5 112693033 missense probably damaging 1.00
R1470:Myo18b UTSW 5 112693033 missense probably damaging 1.00
R1590:Myo18b UTSW 5 112875266 nonsense probably null
R1601:Myo18b UTSW 5 112871498 missense possibly damaging 0.73
R1903:Myo18b UTSW 5 112692758 missense probably damaging 1.00
R1935:Myo18b UTSW 5 112760356 missense probably benign 0.04
R1936:Myo18b UTSW 5 112760356 missense probably benign 0.04
R2008:Myo18b UTSW 5 112873557 missense probably benign
R2127:Myo18b UTSW 5 112831078 missense probably damaging 1.00
R2129:Myo18b UTSW 5 112831078 missense probably damaging 1.00
R2141:Myo18b UTSW 5 112874026 missense probably benign 0.01
R2170:Myo18b UTSW 5 112723858 missense probably benign 0.23
R2258:Myo18b UTSW 5 112874663 unclassified probably benign
R2265:Myo18b UTSW 5 112782673 missense probably damaging 1.00
R2483:Myo18b UTSW 5 112858408 missense probably damaging 1.00
R2931:Myo18b UTSW 5 112693127 missense probably benign 0.01
R3160:Myo18b UTSW 5 112692728 missense probably damaging 0.99
R3162:Myo18b UTSW 5 112692728 missense probably damaging 0.99
R3777:Myo18b UTSW 5 112757596 missense probably damaging 0.99
R4240:Myo18b UTSW 5 112803187 critical splice donor site probably null
R4243:Myo18b UTSW 5 112692395 missense possibly damaging 0.95
R4245:Myo18b UTSW 5 112692395 missense possibly damaging 0.95
R4533:Myo18b UTSW 5 112693025 missense probably damaging 1.00
R4631:Myo18b UTSW 5 112846400 missense probably damaging 1.00
R4661:Myo18b UTSW 5 112875175 unclassified probably benign
R4755:Myo18b UTSW 5 112874474 nonsense probably null
R4771:Myo18b UTSW 5 112692227 nonsense probably null
R4812:Myo18b UTSW 5 112809718 missense possibly damaging 0.95
R4840:Myo18b UTSW 5 112874029 missense probably benign 0.02
R4888:Myo18b UTSW 5 112874480 unclassified probably benign
R4995:Myo18b UTSW 5 112760392 missense probably damaging 0.99
R5001:Myo18b UTSW 5 112761340 missense probably damaging 0.99
R5015:Myo18b UTSW 5 112790057 missense probably damaging 1.00
R5055:Myo18b UTSW 5 112875217 unclassified probably benign
R5070:Myo18b UTSW 5 112761346 missense probably damaging 1.00
R5105:Myo18b UTSW 5 112840778 missense probably damaging 1.00
R5121:Myo18b UTSW 5 112874480 unclassified probably benign
R5130:Myo18b UTSW 5 112873903 missense probably benign 0.06
R5186:Myo18b UTSW 5 112871470 missense probably damaging 1.00
R5437:Myo18b UTSW 5 112757573 missense possibly damaging 0.73
R5535:Myo18b UTSW 5 112790042 missense probably damaging 1.00
R5560:Myo18b UTSW 5 112868295 missense probably damaging 0.96
R5810:Myo18b UTSW 5 112834450 missense probably damaging 1.00
R5898:Myo18b UTSW 5 112802330 intron probably null
R6065:Myo18b UTSW 5 112692781 missense probably benign 0.00
R6104:Myo18b UTSW 5 112874291 unclassified probably benign
R6113:Myo18b UTSW 5 112866385 missense probably damaging 1.00
R6167:Myo18b UTSW 5 112872507 splice site probably null
R6220:Myo18b UTSW 5 112757507 missense possibly damaging 0.93
R6276:Myo18b UTSW 5 112811642 missense probably benign 0.31
R6290:Myo18b UTSW 5 112865735 missense possibly damaging 0.69
R6291:Myo18b UTSW 5 112865735 missense possibly damaging 0.69
R6795:Myo18b UTSW 5 112846364 missense probably damaging 0.99
R6798:Myo18b UTSW 5 112761386 missense probably damaging 0.98
R6817:Myo18b UTSW 5 112830238 missense probably benign 0.00
R6937:Myo18b UTSW 5 112802392 missense probably benign 0.12
R7034:Myo18b UTSW 5 112723904 nonsense probably null
R7097:Myo18b UTSW 5 112874405 missense unknown
R7145:Myo18b UTSW 5 112817679 nonsense probably null
R7201:Myo18b UTSW 5 112715459 missense probably damaging 1.00
R7260:Myo18b UTSW 5 112775288 missense probably benign 0.01
R7265:Myo18b UTSW 5 112812072 missense probably damaging 1.00
Z1088:Myo18b UTSW 5 112692943 missense possibly damaging 0.89
Z1088:Myo18b UTSW 5 112757484 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- TCTACGTGACCTTCTGCCTGAG -3'
(R):5'- ACGGGACAGCTATCAGAGTC -3'

Sequencing Primer
(F):5'- GCCTGAGGCTTCACCACATC -3'
(R):5'- GACAGCTATCAGAGTCCACGG -3'
Posted On2017-10-10