Incidental Mutation 'R0528:Soga1'
ID48972
Institutional Source Beutler Lab
Gene Symbol Soga1
Ensembl Gene ENSMUSG00000055485
Gene Namesuppressor of glucose, autophagy associated 1
SynonymsD430036N24Rik, 9830001H06Rik
MMRRC Submission 038720-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.323) question?
Stock #R0528 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location157015799-157079254 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 157020692 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 1439 (L1439P)
Ref Sequence ENSEMBL: ENSMUSP00000066556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069098]
Predicted Effect probably damaging
Transcript: ENSMUST00000069098
AA Change: L1439P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066556
Gene: ENSMUSG00000055485
AA Change: L1439P

DomainStartEndE-ValueType
low complexity region 15 23 N/A INTRINSIC
low complexity region 51 66 N/A INTRINSIC
low complexity region 97 112 N/A INTRINSIC
low complexity region 132 148 N/A INTRINSIC
low complexity region 155 174 N/A INTRINSIC
Blast:BRLZ 212 246 4e-8 BLAST
SCOP:d1fxkc_ 216 350 1e-3 SMART
Pfam:DUF3166 378 472 2.3e-31 PFAM
Pfam:DUF3166 504 593 5.3e-31 PFAM
low complexity region 637 649 N/A INTRINSIC
coiled coil region 807 867 N/A INTRINSIC
low complexity region 872 884 N/A INTRINSIC
low complexity region 938 950 N/A INTRINSIC
Pfam:DUF4482 1065 1205 3.9e-28 PFAM
low complexity region 1311 1321 N/A INTRINSIC
low complexity region 1363 1377 N/A INTRINSIC
low complexity region 1389 1418 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153229
Meta Mutation Damage Score 0.402 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.9%
Validation Efficiency 96% (65/68)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T G 10: 80,003,014 W674G probably damaging Het
Abcc9 G A 6: 142,692,880 H103Y probably damaging Het
Ano7 A G 1: 93,395,502 N495S probably null Het
Ash1l A G 3: 88,982,277 N488D probably benign Het
Astn2 A G 4: 65,644,882 probably benign Het
Atraid T A 5: 31,052,452 probably benign Het
Baz2b T C 2: 59,936,739 R866G probably damaging Het
Cep164 T A 9: 45,776,936 probably benign Het
Clec4f G A 6: 83,652,794 Q261* probably null Het
Cpne4 A T 9: 104,686,441 N6Y probably damaging Het
Dhx38 G T 8: 109,562,661 Q36K probably benign Het
Dna2 C A 10: 62,958,131 Q341K probably benign Het
Dynap A G 18: 70,242,094 probably benign Het
Eif3l T C 15: 79,089,609 V408A probably benign Het
Foxi3 T A 6: 70,957,138 I203N probably damaging Het
Gcc2 T A 10: 58,298,689 L1495Q probably damaging Het
Gpr158 A G 2: 21,825,208 D688G probably damaging Het
Hcfc2 C A 10: 82,739,245 T246K probably damaging Het
Hdc C T 2: 126,616,232 E57K probably benign Het
Iqsec3 G C 6: 121,412,784 probably benign Het
Islr2 T A 9: 58,199,362 E205V probably damaging Het
Klf9 T C 19: 23,142,134 L127P probably benign Het
Lamc2 A T 1: 153,124,094 L1173Q probably damaging Het
Lipe G A 7: 25,398,476 T14I possibly damaging Het
Lnpep A G 17: 17,531,132 probably benign Het
Lrrc15 A G 16: 30,273,748 S258P probably damaging Het
Macc1 A T 12: 119,447,045 Y516F probably benign Het
Megf6 A G 4: 154,259,173 T718A probably benign Het
Myh1 A G 11: 67,220,619 D1628G probably damaging Het
Naca C T 10: 128,043,293 T1398I probably benign Het
Olfr1366 A G 13: 21,537,246 F238S possibly damaging Het
Olfr441 A T 6: 43,116,216 H158L possibly damaging Het
Padi4 A G 4: 140,769,429 V52A possibly damaging Het
Paqr5 G A 9: 61,956,245 T251I probably damaging Het
Pcm1 A G 8: 41,315,930 D1611G probably damaging Het
Prss12 G A 3: 123,482,796 R358K probably benign Het
Racgap1 A T 15: 99,628,706 H325Q probably damaging Het
Rbm12b1 A G 4: 12,145,657 H543R probably benign Het
Rc3h1 A T 1: 160,967,658 N1076I probably damaging Het
Rp1 A G 1: 4,344,865 L2008P possibly damaging Het
Rsph3a A G 17: 7,946,087 H93R possibly damaging Het
Sbf1 C T 15: 89,288,712 R1840H probably damaging Het
Svs1 T A 6: 48,988,031 D324E probably benign Het
Sytl2 T C 7: 90,403,020 probably benign Het
Tbc1d9 T C 8: 83,210,456 S56P probably damaging Het
Tiam2 A T 17: 3,511,071 M1304L probably damaging Het
Tmprss11b G T 5: 86,671,894 R9S probably damaging Het
Tnfrsf21 T A 17: 43,037,614 I39N probably benign Het
Tnrc6b T C 15: 80,879,403 S369P probably benign Het
Tpra1 T C 6: 88,910,390 V217A probably benign Het
Uckl1 G C 2: 181,570,490 probably benign Het
Vmn1r199 A T 13: 22,382,566 Q10L probably benign Het
Vmn2r76 A G 7: 86,230,298 S265P possibly damaging Het
Vwa5b1 A T 4: 138,594,351 L377Q probably damaging Het
Wdr61 T A 9: 54,722,935 probably benign Het
Wrap73 A G 4: 154,145,319 D49G probably damaging Het
Zfp764 T A 7: 127,404,879 Q360L possibly damaging Het
Zfp846 G A 9: 20,587,928 probably benign Het
Zranb2 T C 3: 157,534,459 I14T probably benign Het
Other mutations in Soga1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Soga1 APN 2 157030864 missense probably damaging 1.00
IGL00924:Soga1 APN 2 157040705 missense probably damaging 0.99
IGL01723:Soga1 APN 2 157030614 missense probably benign 0.00
IGL01749:Soga1 APN 2 157021541 splice site probably benign
IGL02199:Soga1 APN 2 157030945 missense probably damaging 1.00
IGL02262:Soga1 APN 2 157030906 missense probably damaging 1.00
IGL02618:Soga1 APN 2 157040566 missense probably damaging 1.00
IGL02643:Soga1 APN 2 157040743 missense probably damaging 1.00
deglutition UTSW 2 157039864 missense possibly damaging 0.63
gulp UTSW 2 157023817 nonsense probably null
IGL02835:Soga1 UTSW 2 157041934 missense possibly damaging 0.91
R0535:Soga1 UTSW 2 157033289 missense possibly damaging 0.89
R0726:Soga1 UTSW 2 157060262 missense probably damaging 1.00
R1473:Soga1 UTSW 2 157020448 nonsense probably null
R1589:Soga1 UTSW 2 157027637 missense probably benign 0.05
R1615:Soga1 UTSW 2 157020743 missense probably damaging 1.00
R1681:Soga1 UTSW 2 157030530 missense possibly damaging 0.70
R1701:Soga1 UTSW 2 157030619 missense probably damaging 1.00
R1872:Soga1 UTSW 2 157040261 missense possibly damaging 0.88
R2056:Soga1 UTSW 2 157022827 missense probably benign 0.00
R2118:Soga1 UTSW 2 157033325 missense probably damaging 1.00
R2120:Soga1 UTSW 2 157033325 missense probably damaging 1.00
R2121:Soga1 UTSW 2 157033325 missense probably damaging 1.00
R2124:Soga1 UTSW 2 157033325 missense probably damaging 1.00
R2249:Soga1 UTSW 2 157040093 missense probably benign 0.08
R3147:Soga1 UTSW 2 157020364 missense possibly damaging 0.91
R3758:Soga1 UTSW 2 157020638 missense possibly damaging 0.77
R4601:Soga1 UTSW 2 157039924 missense probably benign 0.41
R4646:Soga1 UTSW 2 157020506 missense probably damaging 1.00
R4653:Soga1 UTSW 2 157040591 missense probably damaging 1.00
R4736:Soga1 UTSW 2 157020554 missense probably damaging 1.00
R4773:Soga1 UTSW 2 157030569 missense probably benign 0.08
R4796:Soga1 UTSW 2 157020252 missense probably benign
R4999:Soga1 UTSW 2 157022856 missense probably benign 0.10
R5304:Soga1 UTSW 2 157023817 nonsense probably null
R5369:Soga1 UTSW 2 157040734 missense probably damaging 1.00
R5530:Soga1 UTSW 2 157020342 missense probably damaging 1.00
R5712:Soga1 UTSW 2 157030921 missense probably damaging 1.00
R5780:Soga1 UTSW 2 157018490 missense probably damaging 0.98
R6162:Soga1 UTSW 2 157039864 missense possibly damaging 0.63
R6253:Soga1 UTSW 2 157021419 missense probably benign 0.00
R6303:Soga1 UTSW 2 157040764 missense possibly damaging 0.91
R6304:Soga1 UTSW 2 157040764 missense possibly damaging 0.91
R6523:Soga1 UTSW 2 157060343 nonsense probably null
R7216:Soga1 UTSW 2 157018370 missense possibly damaging 0.76
R7335:Soga1 UTSW 2 157031005 missense possibly damaging 0.86
R7562:Soga1 UTSW 2 157053589 missense probably damaging 1.00
X0019:Soga1 UTSW 2 157020264 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AACAATGCCATACTTGGGAGGCTC -3'
(R):5'- AGACCATTCGGACGGTCAGTGTAG -3'

Sequencing Primer
(F):5'- AGTTTCCACACAGACTCGGTG -3'
(R):5'- AGTGTAGGTCTTCAGACCGAC -3'
Posted On2013-06-12