Incidental Mutation 'R6158:Vwce'
ID489731
Institutional Source Beutler Lab
Gene Symbol Vwce
Ensembl Gene ENSMUSG00000043789
Gene Namevon Willebrand factor C and EGF domains
Synonyms1300015B04Rik
MMRRC Submission 044305-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R6158 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location10634233-10665210 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 10644221 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 206 (R206C)
Ref Sequence ENSEMBL: ENSMUSP00000056958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055115]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055115
AA Change: R206C

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000056958
Gene: ENSMUSG00000043789
AA Change: R206C

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
EGF 70 98 2.2e1 SMART
EGF_CA 142 180 6.91e-9 SMART
EGF_CA 181 219 7.75e-12 SMART
EGF_CA 220 262 1.11e-12 SMART
low complexity region 294 312 N/A INTRINSIC
low complexity region 335 353 N/A INTRINSIC
VWC 378 432 2.91e-6 SMART
VWC 435 488 4.58e-4 SMART
VWC 493 551 2.06e-6 SMART
VWC 560 617 9.74e-8 SMART
VWC 621 676 1.35e-10 SMART
VWC 679 725 2.58e-1 SMART
low complexity region 761 772 N/A INTRINSIC
low complexity region 889 903 N/A INTRINSIC
Meta Mutation Damage Score 0.0628 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.5%
  • 20x: 92.6%
Validation Efficiency 98% (65/66)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T C 12: 71,170,636 V793A possibly damaging Het
2900092C05Rik A G 7: 12,512,672 T32A probably benign Het
Adprhl1 C T 8: 13,224,977 V594M possibly damaging Het
Ano3 A T 2: 110,665,875 Y845N probably damaging Het
Arhgap24 A T 5: 102,892,912 I575L probably benign Het
Aurka A C 2: 172,363,596 probably null Het
C1qtnf5 A T 9: 44,108,970 probably benign Het
Cacnb2 A G 2: 14,985,601 D454G possibly damaging Het
Ccdc58 T A 16: 36,089,929 V118D probably damaging Het
Chchd5 T C 2: 129,130,517 L87P probably damaging Het
Col7a1 G T 9: 108,964,603 R1377L unknown Het
Cpne8 A C 15: 90,571,988 S191A probably damaging Het
Dhx30 A T 9: 110,087,030 I671N probably damaging Het
Dnah12 A T 14: 26,773,685 K1423N possibly damaging Het
Dnm3 T C 1: 162,320,987 M272V probably damaging Het
Fat4 A T 3: 38,983,262 S3688C possibly damaging Het
Frmpd1 A T 4: 45,285,401 L1407F probably damaging Het
Fry T C 5: 150,454,572 S410P probably damaging Het
Gm11565 T A 11: 99,914,918 C45* probably null Het
Gngt1 A T 6: 3,994,311 R30* probably null Het
Htt T C 5: 34,907,086 I2943T possibly damaging Het
Kl T A 5: 150,988,853 M689K possibly damaging Het
Lmo7 T A 14: 101,900,137 D247E probably benign Het
Mastl G T 2: 23,132,772 N646K possibly damaging Het
Mei4 G T 9: 81,927,576 L237F probably damaging Het
Mettl27 C T 5: 134,940,576 P170S possibly damaging Het
Mgam T A 6: 40,757,714 I896K probably damaging Het
Moxd1 T A 10: 24,284,777 C443S probably damaging Het
Myo18b A T 5: 112,874,172 N451K probably benign Het
Myo7b T C 18: 31,988,549 I768V probably benign Het
Nos1 A C 5: 117,867,574 I120L probably benign Het
Nsd1 T C 13: 55,245,621 V345A probably benign Het
Olfr1095 A G 2: 86,851,515 L61P possibly damaging Het
Olfr1205 T C 2: 88,831,146 F10L probably damaging Het
Olfr150 C T 9: 39,737,076 T87I probably benign Het
Olfr170 C A 16: 19,605,925 V248F probably damaging Het
Olfr344 A T 2: 36,569,116 T173S probably benign Het
Pdzph1 T G 17: 58,973,627 Q553H probably damaging Het
Piwil1 T A 5: 128,747,876 L546* probably null Het
Pla2g4f T C 2: 120,301,071 T724A probably benign Het
Ralgapa2 A T 2: 146,424,676 M660K possibly damaging Het
Rgsl1 T C 1: 153,804,021 D103G possibly damaging Het
Rnf186 A G 4: 138,967,254 D35G probably damaging Het
Rock2 A G 12: 16,954,918 D424G probably benign Het
Scg2 A T 1: 79,435,400 D495E probably damaging Het
Slc39a2 G A 14: 51,894,224 probably null Het
Snrnp48 T A 13: 38,210,236 Y100* probably null Het
Spaca1 A G 4: 34,029,176 M99T probably damaging Het
Specc1 T G 11: 62,118,124 F235L probably damaging Het
St13 A T 15: 81,399,601 probably null Het
Swap70 T A 7: 110,270,023 M341K probably damaging Het
Synj2 A G 17: 5,986,212 D67G probably benign Het
Tmem135 T A 7: 89,156,444 I251F probably benign Het
Tmem87a A T 2: 120,360,103 probably null Het
Tom1l2 C T 11: 60,232,927 D128N probably damaging Het
Tpx2 C A 2: 152,873,104 H82N probably benign Het
Trip12 A T 1: 84,761,012 C738S possibly damaging Het
Ttyh1 A G 7: 4,125,562 T153A probably benign Het
Utrn C T 10: 12,690,822 G1199S probably benign Het
Vmn1r8 T A 6: 57,036,289 N108K probably benign Het
Vmn2r63 T A 7: 42,933,680 D37V probably damaging Het
Wrn G T 8: 33,319,172 F265L probably damaging Het
Zfp472 T A 17: 32,978,389 C479* probably null Het
Zfp831 A T 2: 174,643,858 T109S possibly damaging Het
Znfx1 G T 2: 167,056,726 Q93K probably benign Het
Other mutations in Vwce
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Vwce APN 19 10664511 unclassified probably null
IGL01358:Vwce APN 19 10664409 missense possibly damaging 0.86
IGL02330:Vwce APN 19 10646801 missense possibly damaging 0.96
IGL02477:Vwce APN 19 10664618 unclassified probably null
IGL02551:Vwce APN 19 10645036 missense possibly damaging 0.71
IGL02606:Vwce APN 19 10655348 splice site probably benign
IGL02633:Vwce APN 19 10648494 missense probably damaging 0.98
IGL02656:Vwce APN 19 10664352 missense probably benign
IGL02884:Vwce APN 19 10646579 missense possibly damaging 0.53
IGL02973:Vwce APN 19 10655400 nonsense probably null
IGL03038:Vwce APN 19 10646671 missense possibly damaging 0.86
IGL03329:Vwce APN 19 10659996 missense possibly damaging 0.73
PIT4403001:Vwce UTSW 19 10638097 missense possibly damaging 0.53
PIT4431001:Vwce UTSW 19 10664582 missense possibly damaging 0.53
PIT4519001:Vwce UTSW 19 10664582 missense possibly damaging 0.53
R0042:Vwce UTSW 19 10646813 missense probably benign
R0081:Vwce UTSW 19 10664089 critical splice acceptor site probably null
R0142:Vwce UTSW 19 10664612 missense probably damaging 0.97
R0165:Vwce UTSW 19 10659973 splice site probably benign
R0948:Vwce UTSW 19 10653077 missense probably damaging 1.00
R1053:Vwce UTSW 19 10664099 missense probably benign 0.18
R1505:Vwce UTSW 19 10664244 missense probably benign
R1623:Vwce UTSW 19 10646744 nonsense probably null
R1672:Vwce UTSW 19 10653095 missense possibly damaging 0.92
R1882:Vwce UTSW 19 10638156 missense possibly damaging 0.53
R3849:Vwce UTSW 19 10646905 missense probably damaging 0.97
R4292:Vwce UTSW 19 10659632 missense probably benign 0.00
R4293:Vwce UTSW 19 10659632 missense probably benign 0.00
R4531:Vwce UTSW 19 10664346 missense probably benign 0.01
R4678:Vwce UTSW 19 10664648 missense possibly damaging 0.86
R4720:Vwce UTSW 19 10648467 missense possibly damaging 0.85
R4737:Vwce UTSW 19 10650579 missense probably benign 0.33
R4864:Vwce UTSW 19 10650636 missense probably benign 0.01
R4916:Vwce UTSW 19 10646879 missense probably damaging 0.98
R4939:Vwce UTSW 19 10645050 missense probably damaging 0.98
R5605:Vwce UTSW 19 10658038 missense possibly damaging 0.95
R5735:Vwce UTSW 19 10647067 missense probably benign 0.08
R5780:Vwce UTSW 19 10650619 missense probably damaging 1.00
R6383:Vwce UTSW 19 10659592 nonsense probably null
R6920:Vwce UTSW 19 10664693 missense probably benign
R7201:Vwce UTSW 19 10638115 missense possibly damaging 0.72
R7276:Vwce UTSW 19 10664174 missense possibly damaging 0.53
X0018:Vwce UTSW 19 10656662 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TGTTCCTCAGCCTAGAGACAAAG -3'
(R):5'- ATGCTCTGAACAAAGGCTCC -3'

Sequencing Primer
(F):5'- GGTGGAGACCATCAGCTG -3'
(R):5'- TCTGAACAAAGGCTCCACGGG -3'
Posted On2017-10-10