Incidental Mutation 'R6159:Gm14496'
ID489737
Institutional Source Beutler Lab
Gene Symbol Gm14496
Ensembl Gene ENSMUSG00000098505
Gene Namepredicted gene 14496
Synonyms
MMRRC Submission 044306-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6159 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location181991226-182001766 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 181996257 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 375 (T375A)
Ref Sequence ENSEMBL: ENSMUSP00000071670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071760]
Predicted Effect probably benign
Transcript: ENSMUST00000071760
AA Change: T375A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000071670
Gene: ENSMUSG00000098505
AA Change: T375A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 76 456 1.3e-30 PFAM
Pfam:NCD3G 508 562 1.9e-18 PFAM
Pfam:7tm_3 595 830 7.9e-55 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000089788
SMART Domains Protein: ENSMUSP00000087221
Gene: ENSMUSG00000053277

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 76 425 2.8e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184507
Meta Mutation Damage Score 0.0912 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 96% (54/56)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahcyl2 A C 6: 29,908,458 N609T possibly damaging Het
Ankzf1 G A 1: 75,194,244 C98Y probably damaging Het
Atg101 T A 15: 101,290,638 M208K possibly damaging Het
Baiap2l2 A G 15: 79,259,730 I388T probably benign Het
Cabs1 C T 5: 87,979,754 T88I possibly damaging Het
Chrnd T A 1: 87,191,090 D56E probably benign Het
Col28a1 A T 6: 8,162,247 probably null Het
Col4a1 G T 8: 11,220,007 P899Q probably damaging Het
Cts3 C A 13: 61,566,841 A217S probably damaging Het
Dab2 A G 15: 6,436,460 N495S possibly damaging Het
Dnah2 T A 11: 69,458,542 I2423F probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dock6 T C 9: 21,821,745 H1053R probably benign Het
Fam184a G A 10: 53,698,773 L191F probably damaging Het
Fip1l1 C T 5: 74,591,947 R472W probably damaging Het
Gbp2 T C 3: 142,632,257 F378S probably damaging Het
Ggt1 A T 10: 75,584,965 E388V probably damaging Het
Gm2035 G A 12: 87,919,751 A36V probably damaging Het
Gm43302 A G 5: 105,289,028 S71P probably benign Het
Gnrhr G T 5: 86,182,357 T268K probably damaging Het
Htt T C 5: 34,804,676 V335A probably benign Het
Klhl20 A T 1: 161,105,467 L257H probably damaging Het
Lrrc29 T C 8: 105,323,293 Y33C probably damaging Het
Med27 C A 2: 29,524,364 probably null Het
Muc5ac T A 7: 141,815,586 C2433S possibly damaging Het
Nasp A G 4: 116,603,889 probably null Het
Nipal2 A C 15: 34,600,026 V215G probably damaging Het
Olfr121 A T 17: 37,752,147 I98F probably damaging Het
Olfr1505 C T 19: 13,919,740 T240I probably damaging Het
Oxct2b G A 4: 123,117,451 R388H probably damaging Het
Pbrm1 A G 14: 31,052,283 I469V possibly damaging Het
Phyhip A G 14: 70,466,854 H171R possibly damaging Het
Pigs C T 11: 78,328,500 T9M probably benign Het
Plek T C 11: 16,985,539 D256G probably damaging Het
Prss50 T C 9: 110,864,303 V369A probably benign Het
Psmc5 A G 11: 106,261,262 K82E possibly damaging Het
Qrsl1 A T 10: 43,882,193 F301L probably benign Het
Rasal1 T C 5: 120,659,608 L135P probably damaging Het
Rbm47 A G 5: 66,026,816 V148A probably damaging Het
Scyl1 T A 19: 5,764,757 D381V probably benign Het
Selplg G T 5: 113,819,101 D381E probably benign Het
Sh3rf2 C A 18: 42,156,135 Q674K probably damaging Het
Sned1 A G 1: 93,282,937 T987A probably benign Het
Sntb1 A G 15: 55,676,302 probably null Het
Synj2 A T 17: 5,986,052 I14F probably damaging Het
Taf2 A T 15: 55,063,044 M170K possibly damaging Het
Tg A G 15: 66,735,247 E211G possibly damaging Het
Thnsl1 G T 2: 21,212,205 E257* probably null Het
Tlr4 A G 4: 66,839,833 R288G possibly damaging Het
Trbc1 T C 6: 41,538,451 probably benign Het
Trim37 G A 11: 87,216,548 probably null Het
Txnrd3 T C 6: 89,663,194 probably null Het
Tyk2 C A 9: 21,110,504 Q875H probably damaging Het
Vmn2r55 A G 7: 12,651,771 Y761H probably damaging Het
Zswim5 T C 4: 116,979,679 L720P probably damaging Het
Other mutations in Gm14496
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01144:Gm14496 APN 2 181995021 missense probably damaging 1.00
IGL01300:Gm14496 APN 2 182000960 missense probably damaging 1.00
IGL01328:Gm14496 APN 2 181995880 missense probably damaging 1.00
IGL01526:Gm14496 APN 2 181995665 missense probably benign 0.12
IGL01576:Gm14496 APN 2 181991371 missense possibly damaging 0.92
IGL01775:Gm14496 APN 2 182000332 missense probably benign 0.00
IGL02020:Gm14496 APN 2 181996089 missense possibly damaging 0.95
IGL02150:Gm14496 APN 2 181991347 missense probably damaging 0.99
IGL02170:Gm14496 APN 2 181996351 missense probably damaging 1.00
IGL02262:Gm14496 APN 2 181996012 missense probably damaging 1.00
IGL02398:Gm14496 APN 2 181996170 missense probably benign 0.09
IGL02414:Gm14496 APN 2 181991405 missense probably benign 0.03
IGL02541:Gm14496 APN 2 182000393 missense probably benign 0.29
IGL02741:Gm14496 APN 2 181991343 missense probably benign
IGL02933:Gm14496 APN 2 182000463 missense probably benign 0.15
IGL03214:Gm14496 APN 2 182000536 missense probably damaging 1.00
FR4342:Gm14496 UTSW 2 181995906 missense probably benign 0.01
R0158:Gm14496 UTSW 2 181997413 missense probably benign 0.07
R0271:Gm14496 UTSW 2 181995954 missense probably benign 0.44
R0611:Gm14496 UTSW 2 181995111 missense probably benign 0.00
R0833:Gm14496 UTSW 2 181996266 missense probably damaging 0.99
R0834:Gm14496 UTSW 2 181995687 missense probably benign 0.00
R0906:Gm14496 UTSW 2 182000515 missense probably damaging 0.98
R1298:Gm14496 UTSW 2 181996092 missense probably benign 0.39
R1500:Gm14496 UTSW 2 181991233 missense probably benign 0.21
R1585:Gm14496 UTSW 2 181996209 missense possibly damaging 0.79
R1610:Gm14496 UTSW 2 181996179 missense probably benign 0.01
R1627:Gm14496 UTSW 2 181998778 missense probably damaging 1.00
R1635:Gm14496 UTSW 2 182001044 missense possibly damaging 0.88
R1663:Gm14496 UTSW 2 181997437 missense probably benign 0.03
R1792:Gm14496 UTSW 2 181996153 missense probably benign 0.00
R1888:Gm14496 UTSW 2 182000196 nonsense probably null
R1888:Gm14496 UTSW 2 182000196 nonsense probably null
R1922:Gm14496 UTSW 2 182001004 missense probably benign 0.22
R2081:Gm14496 UTSW 2 182000479 missense probably damaging 1.00
R2102:Gm14496 UTSW 2 181991334 missense possibly damaging 0.88
R2176:Gm14496 UTSW 2 181991337 missense probably benign
R4154:Gm14496 UTSW 2 181995079 missense probably benign 0.01
R4789:Gm14496 UTSW 2 181995784 missense possibly damaging 0.85
R4873:Gm14496 UTSW 2 181997433 missense probably damaging 0.99
R4875:Gm14496 UTSW 2 181997433 missense probably damaging 0.99
R5020:Gm14496 UTSW 2 181991359 missense possibly damaging 0.67
R5354:Gm14496 UTSW 2 182000809 missense probably damaging 1.00
R5361:Gm14496 UTSW 2 182000354 missense probably benign 0.07
R5457:Gm14496 UTSW 2 181997608 missense probably damaging 0.96
R5589:Gm14496 UTSW 2 181995881 nonsense probably null
R5655:Gm14496 UTSW 2 181996182 missense probably benign 0.06
R6007:Gm14496 UTSW 2 181997530 missense probably benign 0.37
R6123:Gm14496 UTSW 2 181991227 start codon destroyed probably null 1.00
R6168:Gm14496 UTSW 2 182000957 missense probably damaging 1.00
R6454:Gm14496 UTSW 2 181996222 missense probably damaging 0.97
R6502:Gm14496 UTSW 2 182000593 missense probably benign 0.01
R6649:Gm14496 UTSW 2 181997476 missense possibly damaging 0.83
R6996:Gm14496 UTSW 2 181996204 missense probably damaging 1.00
R7043:Gm14496 UTSW 2 182000327 missense possibly damaging 0.70
R7317:Gm14496 UTSW 2 181995820 missense possibly damaging 0.56
R7354:Gm14496 UTSW 2 182000686 missense probably damaging 1.00
X0058:Gm14496 UTSW 2 181995986 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTCACTTTTGCACACTACAAAGG -3'
(R):5'- GCGTTTTGCAGTGTAGAAATCTTTC -3'

Sequencing Primer
(F):5'- TTGCACACTACAAAGGTGAGATTCC -3'
(R):5'- GTGTAGAAATCTTTCCACTGAGAG -3'
Posted On2017-10-10