Incidental Mutation 'R6159:Gnrhr'
ID489745
Institutional Source Beutler Lab
Gene Symbol Gnrhr
Ensembl Gene ENSMUSG00000029255
Gene Namegonadotropin releasing hormone receptor
Synonyms
MMRRC Submission 044306-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R6159 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location86180754-86197901 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 86182357 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 268 (T268K)
Ref Sequence ENSEMBL: ENSMUSP00000031172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031172] [ENSMUST00000094654] [ENSMUST00000113372]
Predicted Effect probably damaging
Transcript: ENSMUST00000031172
AA Change: T268K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031172
Gene: ENSMUSG00000029255
AA Change: T268K

DomainStartEndE-ValueType
Pfam:7tm_1 63 322 2.8e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094654
SMART Domains Protein: ENSMUSP00000092238
Gene: ENSMUSG00000029255

DomainStartEndE-ValueType
Pfam:7tm_1 62 261 6.7e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113372
SMART Domains Protein: ENSMUSP00000108999
Gene: ENSMUSG00000029255

DomainStartEndE-ValueType
Pfam:7tm_1 60 177 4.5e-20 PFAM
Meta Mutation Damage Score 0.072 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the receptor for type 1 gonadotropin-releasing hormone. This receptor is a member of the seven-transmembrane, G-protein coupled receptor (GPCR) family. It is expressed on the surface of pituitary gonadotrope cells as well as lymphocytes, breast, ovary, and prostate. Following binding of gonadotropin-releasing hormone, the receptor associates with G-proteins that activate a phosphatidylinositol-calcium second messenger system. Activation of the receptor ultimately causes the release of gonadotropic luteinizing hormone (LH) and follicle stimulating hormone (FSH). Defects in this gene are a cause of hypogonadotropic hypogonadism (HH). Alternative splicing results in multiple transcript variants encoding different isoforms. More than 18 transcription initiation sites in the 5' region and multiple polyA signals in the 3' region have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice display prepubescent internal reproductive tracts with hypogonadism and hypogonadotrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahcyl2 A C 6: 29,908,458 N609T possibly damaging Het
Ankzf1 G A 1: 75,194,244 C98Y probably damaging Het
Atg101 T A 15: 101,290,638 M208K possibly damaging Het
Baiap2l2 A G 15: 79,259,730 I388T probably benign Het
Cabs1 C T 5: 87,979,754 T88I possibly damaging Het
Chrnd T A 1: 87,191,090 D56E probably benign Het
Col28a1 A T 6: 8,162,247 probably null Het
Col4a1 G T 8: 11,220,007 P899Q probably damaging Het
Cts3 C A 13: 61,566,841 A217S probably damaging Het
Dab2 A G 15: 6,436,460 N495S possibly damaging Het
Dnah2 T A 11: 69,458,542 I2423F probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dock6 T C 9: 21,821,745 H1053R probably benign Het
Fam184a G A 10: 53,698,773 L191F probably damaging Het
Fip1l1 C T 5: 74,591,947 R472W probably damaging Het
Gbp2 T C 3: 142,632,257 F378S probably damaging Het
Ggt1 A T 10: 75,584,965 E388V probably damaging Het
Gm14496 A G 2: 181,996,257 T375A probably benign Het
Gm2035 G A 12: 87,919,751 A36V probably damaging Het
Gm43302 A G 5: 105,289,028 S71P probably benign Het
Htt T C 5: 34,804,676 V335A probably benign Het
Klhl20 A T 1: 161,105,467 L257H probably damaging Het
Lrrc29 T C 8: 105,323,293 Y33C probably damaging Het
Med27 C A 2: 29,524,364 probably null Het
Muc5ac T A 7: 141,815,586 C2433S possibly damaging Het
Nasp A G 4: 116,603,889 probably null Het
Nipal2 A C 15: 34,600,026 V215G probably damaging Het
Olfr121 A T 17: 37,752,147 I98F probably damaging Het
Olfr1505 C T 19: 13,919,740 T240I probably damaging Het
Oxct2b G A 4: 123,117,451 R388H probably damaging Het
Pbrm1 A G 14: 31,052,283 I469V possibly damaging Het
Phyhip A G 14: 70,466,854 H171R possibly damaging Het
Pigs C T 11: 78,328,500 T9M probably benign Het
Plek T C 11: 16,985,539 D256G probably damaging Het
Prss50 T C 9: 110,864,303 V369A probably benign Het
Psmc5 A G 11: 106,261,262 K82E possibly damaging Het
Qrsl1 A T 10: 43,882,193 F301L probably benign Het
Rasal1 T C 5: 120,659,608 L135P probably damaging Het
Rbm47 A G 5: 66,026,816 V148A probably damaging Het
Scyl1 T A 19: 5,764,757 D381V probably benign Het
Selplg G T 5: 113,819,101 D381E probably benign Het
Sh3rf2 C A 18: 42,156,135 Q674K probably damaging Het
Sned1 A G 1: 93,282,937 T987A probably benign Het
Sntb1 A G 15: 55,676,302 probably null Het
Synj2 A T 17: 5,986,052 I14F probably damaging Het
Taf2 A T 15: 55,063,044 M170K possibly damaging Het
Tg A G 15: 66,735,247 E211G possibly damaging Het
Thnsl1 G T 2: 21,212,205 E257* probably null Het
Tlr4 A G 4: 66,839,833 R288G possibly damaging Het
Trbc1 T C 6: 41,538,451 probably benign Het
Trim37 G A 11: 87,216,548 probably null Het
Txnrd3 T C 6: 89,663,194 probably null Het
Tyk2 C A 9: 21,110,504 Q875H probably damaging Het
Vmn2r55 A G 7: 12,651,771 Y761H probably damaging Het
Zswim5 T C 4: 116,979,679 L720P probably damaging Het
Other mutations in Gnrhr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00980:Gnrhr APN 5 86197303 critical splice donor site probably null
IGL01432:Gnrhr APN 5 86182193 missense probably damaging 1.00
IGL02702:Gnrhr APN 5 86182269 missense possibly damaging 0.69
IGL03367:Gnrhr APN 5 86182331 missense probably benign 0.02
R0483:Gnrhr UTSW 5 86197575 missense probably damaging 1.00
R1873:Gnrhr UTSW 5 86182201 missense probably damaging 1.00
R2199:Gnrhr UTSW 5 86197818 missense probably benign 0.26
R2303:Gnrhr UTSW 5 86197749 missense probably benign 0.01
R4400:Gnrhr UTSW 5 86182249 unclassified probably null
R5273:Gnrhr UTSW 5 86182246 missense possibly damaging 0.86
R5320:Gnrhr UTSW 5 86197614 missense possibly damaging 0.95
R6221:Gnrhr UTSW 5 86185403 nonsense probably null
R6629:Gnrhr UTSW 5 86182309 missense probably benign 0.01
R6725:Gnrhr UTSW 5 86185313 missense probably damaging 0.97
X0018:Gnrhr UTSW 5 86197755 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- AATACCCATATATGAGTGGGTCG -3'
(R):5'- CAGCTTTATTACATAGCCCAGGC -3'

Sequencing Primer
(F):5'- CCATATATGAGTGGGTCGAAGCAC -3'
(R):5'- CTACAGCTGAATCAGTCCAA -3'
Posted On2017-10-10