Incidental Mutation 'R6159:Rasal1'
ID489749
Institutional Source Beutler Lab
Gene Symbol Rasal1
Ensembl Gene ENSMUSG00000029602
Gene NameRAS protein activator like 1 (GAP1 like)
SynonymsMRASAL
MMRRC Submission 044306-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R6159 (G1)
Quality Score88.0076
Status Validated
Chromosome5
Chromosomal Location120648812-120679597 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120659608 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 135 (L135P)
Ref Sequence ENSEMBL: ENSMUSP00000123266 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031606] [ENSMUST00000125804] [ENSMUST00000156722]
Predicted Effect probably damaging
Transcript: ENSMUST00000031606
AA Change: L135P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031606
Gene: ENSMUSG00000029602
AA Change: L135P

DomainStartEndE-ValueType
C2 6 113 7.74e-13 SMART
C2 134 231 2e-15 SMART
RasGAP 241 604 3.96e-166 SMART
PH 566 674 2.76e-16 SMART
BTK 674 710 2.24e-4 SMART
low complexity region 731 745 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125804
SMART Domains Protein: ENSMUSP00000119913
Gene: ENSMUSG00000029602

DomainStartEndE-ValueType
Pfam:C2 7 73 4.5e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148695
Predicted Effect probably damaging
Transcript: ENSMUST00000156722
AA Change: L135P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123266
Gene: ENSMUSG00000029602
AA Change: L135P

DomainStartEndE-ValueType
C2 6 113 7.74e-13 SMART
C2 134 231 2e-15 SMART
RasGAP 241 604 3.96e-166 SMART
PH 566 674 2.76e-16 SMART
BTK 674 710 2.24e-4 SMART
low complexity region 731 745 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is member of the GAP1 family of GTPase-activating proteins. These proteins stimulate the GTPase activity of normal RAS p21 but not its oncogenic counterpart. Acting as a suppressor of RAS function, the protein enhances the weak intrinsic GTPase activity of RAS proteins resulting in the inactive GDP-bound form of RAS, thereby allowing control of cellular proliferation and differentiation. This particular family member contains domains which are characteristic of the GAP1 subfamily of RasGAP proteins but, in contrast to the other GAP1 family members, this protein is strongly and selectively expressed in endocrine tissues. Alternatively spliced transcript variants that encode different isoforms have been described [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahcyl2 A C 6: 29,908,458 N609T possibly damaging Het
Ankzf1 G A 1: 75,194,244 C98Y probably damaging Het
Atg101 T A 15: 101,290,638 M208K possibly damaging Het
Baiap2l2 A G 15: 79,259,730 I388T probably benign Het
Cabs1 C T 5: 87,979,754 T88I possibly damaging Het
Chrnd T A 1: 87,191,090 D56E probably benign Het
Col28a1 A T 6: 8,162,247 probably null Het
Col4a1 G T 8: 11,220,007 P899Q probably damaging Het
Cts3 C A 13: 61,566,841 A217S probably damaging Het
Dab2 A G 15: 6,436,460 N495S possibly damaging Het
Dnah2 T A 11: 69,458,542 I2423F probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dock6 T C 9: 21,821,745 H1053R probably benign Het
Fam184a G A 10: 53,698,773 L191F probably damaging Het
Fip1l1 C T 5: 74,591,947 R472W probably damaging Het
Gbp2 T C 3: 142,632,257 F378S probably damaging Het
Ggt1 A T 10: 75,584,965 E388V probably damaging Het
Gm14496 A G 2: 181,996,257 T375A probably benign Het
Gm2035 G A 12: 87,919,751 A36V probably damaging Het
Gm43302 A G 5: 105,289,028 S71P probably benign Het
Gnrhr G T 5: 86,182,357 T268K probably damaging Het
Htt T C 5: 34,804,676 V335A probably benign Het
Klhl20 A T 1: 161,105,467 L257H probably damaging Het
Lrrc29 T C 8: 105,323,293 Y33C probably damaging Het
Med27 C A 2: 29,524,364 probably null Het
Muc5ac T A 7: 141,815,586 C2433S possibly damaging Het
Nasp A G 4: 116,603,889 probably null Het
Nipal2 A C 15: 34,600,026 V215G probably damaging Het
Olfr121 A T 17: 37,752,147 I98F probably damaging Het
Olfr1505 C T 19: 13,919,740 T240I probably damaging Het
Oxct2b G A 4: 123,117,451 R388H probably damaging Het
Pbrm1 A G 14: 31,052,283 I469V possibly damaging Het
Phyhip A G 14: 70,466,854 H171R possibly damaging Het
Pigs C T 11: 78,328,500 T9M probably benign Het
Plek T C 11: 16,985,539 D256G probably damaging Het
Prss50 T C 9: 110,864,303 V369A probably benign Het
Psmc5 A G 11: 106,261,262 K82E possibly damaging Het
Qrsl1 A T 10: 43,882,193 F301L probably benign Het
Rbm47 A G 5: 66,026,816 V148A probably damaging Het
Scyl1 T A 19: 5,764,757 D381V probably benign Het
Selplg G T 5: 113,819,101 D381E probably benign Het
Sh3rf2 C A 18: 42,156,135 Q674K probably damaging Het
Sned1 A G 1: 93,282,937 T987A probably benign Het
Sntb1 A G 15: 55,676,302 probably null Het
Synj2 A T 17: 5,986,052 I14F probably damaging Het
Taf2 A T 15: 55,063,044 M170K possibly damaging Het
Tg A G 15: 66,735,247 E211G possibly damaging Het
Thnsl1 G T 2: 21,212,205 E257* probably null Het
Tlr4 A G 4: 66,839,833 R288G possibly damaging Het
Trbc1 T C 6: 41,538,451 probably benign Het
Trim37 G A 11: 87,216,548 probably null Het
Txnrd3 T C 6: 89,663,194 probably null Het
Tyk2 C A 9: 21,110,504 Q875H probably damaging Het
Vmn2r55 A G 7: 12,651,771 Y761H probably damaging Het
Zswim5 T C 4: 116,979,679 L720P probably damaging Het
Other mutations in Rasal1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Rasal1 APN 5 120664807 missense probably damaging 1.00
IGL01700:Rasal1 APN 5 120676817 missense probably benign 0.06
IGL01790:Rasal1 APN 5 120670318 missense possibly damaging 0.61
IGL01866:Rasal1 APN 5 120675423 missense probably damaging 1.00
IGL02143:Rasal1 APN 5 120652852 missense probably damaging 1.00
IGL02527:Rasal1 APN 5 120666404 missense probably damaging 0.98
IGL02565:Rasal1 APN 5 120676780 splice site probably benign
IGL02710:Rasal1 APN 5 120666431 missense possibly damaging 0.71
PIT4618001:Rasal1 UTSW 5 120670376 missense probably damaging 0.99
R0270:Rasal1 UTSW 5 120674729 missense probably damaging 0.97
R0281:Rasal1 UTSW 5 120674605 missense probably benign
R0673:Rasal1 UTSW 5 120670384 missense probably benign 0.26
R1227:Rasal1 UTSW 5 120670307 missense probably damaging 0.99
R1475:Rasal1 UTSW 5 120662982 missense possibly damaging 0.55
R1486:Rasal1 UTSW 5 120654852 missense probably damaging 1.00
R1557:Rasal1 UTSW 5 120676849 missense possibly damaging 0.87
R1651:Rasal1 UTSW 5 120652845 nonsense probably null
R1792:Rasal1 UTSW 5 120664756 missense probably benign 0.06
R2148:Rasal1 UTSW 5 120662031 missense probably damaging 0.97
R2964:Rasal1 UTSW 5 120671620 missense probably damaging 0.99
R2966:Rasal1 UTSW 5 120671620 missense probably damaging 0.99
R2983:Rasal1 UTSW 5 120654862 missense probably benign 0.45
R4090:Rasal1 UTSW 5 120675609 missense possibly damaging 0.95
R4205:Rasal1 UTSW 5 120659563 missense probably benign 0.21
R4643:Rasal1 UTSW 5 120678964 missense probably benign 0.05
R4979:Rasal1 UTSW 5 120678676 missense probably benign
R5171:Rasal1 UTSW 5 120663764 missense probably benign
R5187:Rasal1 UTSW 5 120675395 missense probably benign 0.13
R5877:Rasal1 UTSW 5 120679070 utr 3 prime probably benign
R5924:Rasal1 UTSW 5 120675517 missense probably damaging 1.00
R6037:Rasal1 UTSW 5 120649501 missense possibly damaging 0.55
R6037:Rasal1 UTSW 5 120649501 missense possibly damaging 0.55
R6136:Rasal1 UTSW 5 120675478 missense possibly damaging 0.84
R6292:Rasal1 UTSW 5 120659620 missense probably damaging 0.97
R6548:Rasal1 UTSW 5 120674725 missense probably benign 0.00
R7042:Rasal1 UTSW 5 120663960 splice site probably null
R7194:Rasal1 UTSW 5 120675492 missense probably benign
X0057:Rasal1 UTSW 5 120664512 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGCACCTCATGAGCATCAGG -3'
(R):5'- CGTAGCTATGCACCAAGAAGG -3'

Sequencing Primer
(F):5'- AGGTGCTTCCTAAACACTGTG -3'
(R):5'- CCTCCTGAATGCTGAGATTAGAG -3'
Posted On2017-10-10