Incidental Mutation 'R6160:Rims1'
List |< first << previous [record 53 of 67] next >> last >|
ID489785
Institutional Source Beutler Lab
Gene Symbol Rims1
Ensembl Gene ENSMUSG00000041670
Gene Nameregulating synaptic membrane exocytosis 1
SynonymsRIM1a, RIM1, RIM1alpha, C030033M19Rik
MMRRC Submission 044307-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.617) question?
Stock #R6160 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location22286251-22805994 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 22432984 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 650 (Y650C)
Ref Sequence ENSEMBL: ENSMUSP00000095420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081544] [ENSMUST00000097809] [ENSMUST00000097810] [ENSMUST00000097811] [ENSMUST00000115273]
Predicted Effect probably benign
Transcript: ENSMUST00000081544
AA Change: Y650C

PolyPhen 2 Score 0.174 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000080259
Gene: ENSMUSG00000041670
AA Change: Y650C

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
coiled coil region 30 52 N/A INTRINSIC
Pfam:FYVE_2 102 205 2.6e-9 PFAM
low complexity region 283 293 N/A INTRINSIC
low complexity region 329 345 N/A INTRINSIC
low complexity region 381 394 N/A INTRINSIC
PDZ 449 528 1.44e-15 SMART
low complexity region 535 551 N/A INTRINSIC
C2 593 703 7.55e-1 SMART
low complexity region 710 721 N/A INTRINSIC
low complexity region 899 934 N/A INTRINSIC
low complexity region 1011 1025 N/A INTRINSIC
C2 1120 1223 7.45e-15 SMART
low complexity region 1245 1253 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000097809
AA Change: Y650C

PolyPhen 2 Score 0.729 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000095418
Gene: ENSMUSG00000041670
AA Change: Y650C

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
coiled coil region 30 52 N/A INTRINSIC
Pfam:FYVE_2 102 205 1e-9 PFAM
low complexity region 283 293 N/A INTRINSIC
low complexity region 329 345 N/A INTRINSIC
low complexity region 381 394 N/A INTRINSIC
PDZ 449 528 1.44e-15 SMART
low complexity region 535 551 N/A INTRINSIC
C2 593 703 7.55e-1 SMART
low complexity region 710 721 N/A INTRINSIC
low complexity region 862 874 N/A INTRINSIC
low complexity region 974 1009 N/A INTRINSIC
low complexity region 1086 1100 N/A INTRINSIC
C2 1195 1298 7.45e-15 SMART
low complexity region 1320 1328 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000097810
AA Change: Y650C

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000095419
Gene: ENSMUSG00000041670
AA Change: Y650C

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
coiled coil region 30 52 N/A INTRINSIC
PDB:2CJS|C 131 193 2e-32 PDB
low complexity region 283 293 N/A INTRINSIC
low complexity region 329 345 N/A INTRINSIC
low complexity region 381 394 N/A INTRINSIC
PDZ 449 528 1.44e-15 SMART
low complexity region 535 551 N/A INTRINSIC
C2 593 703 7.55e-1 SMART
low complexity region 710 721 N/A INTRINSIC
low complexity region 862 874 N/A INTRINSIC
low complexity region 916 929 N/A INTRINSIC
low complexity region 1035 1070 N/A INTRINSIC
low complexity region 1147 1161 N/A INTRINSIC
C2 1256 1359 7.45e-15 SMART
low complexity region 1381 1389 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097811
AA Change: Y650C

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000095420
Gene: ENSMUSG00000041670
AA Change: Y650C

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
coiled coil region 30 52 N/A INTRINSIC
Pfam:FYVE_2 102 205 1.6e-9 PFAM
low complexity region 283 293 N/A INTRINSIC
low complexity region 329 345 N/A INTRINSIC
low complexity region 381 394 N/A INTRINSIC
PDZ 449 528 1.44e-15 SMART
low complexity region 535 551 N/A INTRINSIC
C2 593 703 7.55e-1 SMART
low complexity region 710 721 N/A INTRINSIC
low complexity region 867 881 N/A INTRINSIC
low complexity region 944 957 N/A INTRINSIC
low complexity region 1063 1098 N/A INTRINSIC
low complexity region 1175 1189 N/A INTRINSIC
C2 1284 1387 7.45e-15 SMART
low complexity region 1409 1417 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115273
AA Change: Y650C

PolyPhen 2 Score 0.267 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000110928
Gene: ENSMUSG00000041670
AA Change: Y650C

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
coiled coil region 30 52 N/A INTRINSIC
Pfam:FYVE_2 102 205 2.8e-9 PFAM
low complexity region 283 293 N/A INTRINSIC
low complexity region 329 345 N/A INTRINSIC
low complexity region 381 394 N/A INTRINSIC
PDZ 449 528 1.44e-15 SMART
low complexity region 535 551 N/A INTRINSIC
C2 593 703 7.55e-1 SMART
low complexity region 710 721 N/A INTRINSIC
low complexity region 950 985 N/A INTRINSIC
low complexity region 1062 1076 N/A INTRINSIC
C2 1171 1274 7.45e-15 SMART
low complexity region 1296 1304 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185942
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 94% (62/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a RAS gene superfamily member that regulates synaptic vesicle exocytosis. This gene also plays a role in the regulation of voltage-gated calcium channels during neurotransmitter and insulin release. Mutations have suggested a role cognition and have been identified as the cause of cone-rod dystrophy type 7. Multiple transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for disruptions in this gene display defects in maternal care and abnormalities in synaptic transmission in the central nervous system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik G A 6: 149,331,507 probably null Het
4930433I11Rik T A 7: 40,993,526 S297R possibly damaging Het
5530400C23Rik A G 6: 133,294,326 E111G possibly damaging Het
8030423J24Rik T A 13: 70,883,910 S34T unknown Het
Ace3 T A 11: 105,994,732 W20R possibly damaging Het
Adgrf1 A G 17: 43,310,687 E605G probably damaging Het
Arhgap44 G A 11: 65,162,549 probably benign Het
Atm A C 9: 53,490,959 H1404Q probably benign Het
AW209491 A G 13: 14,636,721 E53G probably damaging Het
Cdt1 C T 8: 122,571,368 T366I probably benign Het
Cerk A T 15: 86,142,773 C179S probably benign Het
Cldn10 T C 14: 118,861,843 V123A possibly damaging Het
Clip1 T C 5: 123,613,541 K726E possibly damaging Het
Dcaf12 A T 4: 41,294,043 Y365N probably damaging Het
Dennd6b A G 15: 89,188,821 L171P probably damaging Het
Dip2c G A 13: 9,533,254 V91I probably benign Het
Dlec1 A G 9: 119,143,319 I1431V probably benign Het
Egln1 T C 8: 124,948,492 D188G probably damaging Het
Enpp5 T A 17: 44,081,368 N229K possibly damaging Het
Fmo1 T G 1: 162,836,298 I221L probably benign Het
Fsip2 G A 2: 82,987,945 W4674* probably null Het
Gm12185 G A 11: 48,908,428 Q413* probably null Het
Gm5096 G A 18: 87,757,121 C256Y probably damaging Het
Gm7298 A T 6: 121,764,927 H436L probably benign Het
Gucy2c G A 6: 136,740,686 Q430* probably null Het
Hgd A G 16: 37,613,298 H134R probably damaging Het
Hoxd8 A G 2: 74,705,999 E151G probably damaging Het
Il15ra A G 2: 11,720,016 D99G probably damaging Het
Ints4 T A 7: 97,509,583 probably null Het
Itgb1 T A 8: 128,720,283 F426L possibly damaging Het
Itpr1 A C 6: 108,518,755 I2534L probably benign Het
Kcnq4 T A 4: 120,716,559 H235L probably damaging Het
Kcnt1 T A 2: 25,892,383 I178N probably damaging Het
Kidins220 A G 12: 24,997,311 D252G probably damaging Het
Krt23 A G 11: 99,485,718 I204T probably damaging Het
Lipo4 A G 19: 33,503,293 L225P probably damaging Het
Lrp3 T C 7: 35,204,123 D245G possibly damaging Het
Mmp16 A G 4: 18,051,857 D282G probably damaging Het
Myo1c A T 11: 75,650,742 H18L probably benign Het
Myo1f C A 17: 33,604,344 P981Q probably benign Het
Nle1 A T 11: 82,908,157 F33I probably benign Het
Nlrp4e T G 7: 23,321,306 M406R probably damaging Het
Obscn A T 11: 59,051,785 V4857E probably damaging Het
Palb2 A T 7: 122,128,420 probably null Het
Phospho1 A T 11: 95,830,624 E22V probably damaging Het
Pom121l2 C T 13: 21,983,668 S703L possibly damaging Het
Prex2 T C 1: 10,993,851 L20P probably damaging Het
Psmb7 T C 2: 38,643,381 T45A probably damaging Het
R3hdm2 T C 10: 127,484,507 I532T probably damaging Het
Rcn1 T C 2: 105,392,017 D208G probably damaging Het
Recql5 A G 11: 115,932,787 probably null Het
Rfc4 A T 16: 23,114,683 I242N probably damaging Het
Shc2 C T 10: 79,627,019 probably null Het
Slc14a2 A T 18: 78,158,975 probably null Het
Slc6a6 A T 6: 91,740,014 probably null Het
Synj2 C A 17: 6,008,061 H275N possibly damaging Het
T A T 17: 8,441,786 T410S probably benign Het
Tarsl2 A G 7: 65,682,779 I543V probably benign Het
Tbc1d8 T A 1: 39,372,403 K1117N probably damaging Het
Tm7sf3 A T 6: 146,606,289 L425* probably null Het
Trav14-3 A G 14: 53,763,521 Y63C probably damaging Het
Tyro3 A C 2: 119,803,270 D133A probably damaging Het
Vmn1r119 T G 7: 21,011,815 H214P possibly damaging Het
Vmn2r120 G A 17: 57,509,418 P646S probably benign Het
Zbtb7c A T 18: 76,145,833 Y454F probably benign Het
Zmym2 T C 14: 56,950,309 L1144P probably damaging Het
Other mutations in Rims1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Rims1 APN 1 22468242 missense probably damaging 1.00
IGL00535:Rims1 APN 1 22432921 missense probably benign 0.02
IGL01021:Rims1 APN 1 22486620 missense probably damaging 1.00
IGL01106:Rims1 APN 1 22379447 missense probably damaging 1.00
IGL01128:Rims1 APN 1 22534175 missense probably damaging 0.97
IGL01548:Rims1 APN 1 22538602 missense probably damaging 1.00
IGL01688:Rims1 APN 1 22397540 missense probably benign 0.22
IGL02089:Rims1 APN 1 22630475 missense possibly damaging 0.68
IGL02245:Rims1 APN 1 22346488 missense probably damaging 0.98
IGL02355:Rims1 APN 1 22483207 missense probably damaging 1.00
IGL02362:Rims1 APN 1 22483207 missense probably damaging 1.00
IGL02682:Rims1 APN 1 22288484 missense probably damaging 1.00
IGL03006:Rims1 APN 1 22296954 missense probably damaging 0.99
IGL03054:Rims1 UTSW 1 22290109 missense probably damaging 1.00
PIT4504001:Rims1 UTSW 1 22397460 missense
R0031:Rims1 UTSW 1 22296879 missense probably damaging 1.00
R0118:Rims1 UTSW 1 22346407 missense probably damaging 1.00
R0390:Rims1 UTSW 1 22596526 missense possibly damaging 0.92
R0483:Rims1 UTSW 1 22468182 splice site probably benign
R0744:Rims1 UTSW 1 22427459 splice site probably null
R0836:Rims1 UTSW 1 22427459 splice site probably null
R1218:Rims1 UTSW 1 22483175 missense probably damaging 1.00
R1228:Rims1 UTSW 1 22472756 missense probably null 1.00
R1374:Rims1 UTSW 1 22296948 missense probably damaging 1.00
R1474:Rims1 UTSW 1 22538281 splice site probably benign
R1652:Rims1 UTSW 1 22292866 missense probably damaging 1.00
R1712:Rims1 UTSW 1 22296948 missense probably damaging 1.00
R1730:Rims1 UTSW 1 22346529 critical splice acceptor site probably null
R1783:Rims1 UTSW 1 22346529 critical splice acceptor site probably null
R1861:Rims1 UTSW 1 22596558 missense probably damaging 1.00
R1899:Rims1 UTSW 1 22428474 missense probably damaging 1.00
R1937:Rims1 UTSW 1 22288530 missense probably damaging 1.00
R2010:Rims1 UTSW 1 22296996 missense probably damaging 1.00
R2049:Rims1 UTSW 1 22596435 missense probably damaging 1.00
R2124:Rims1 UTSW 1 22404508 nonsense probably null
R2860:Rims1 UTSW 1 22432976 missense probably benign 0.01
R2861:Rims1 UTSW 1 22432976 missense probably benign 0.01
R2914:Rims1 UTSW 1 22805630 missense probably damaging 1.00
R3740:Rims1 UTSW 1 22373443 missense probably damaging 1.00
R3741:Rims1 UTSW 1 22373443 missense probably damaging 1.00
R3773:Rims1 UTSW 1 22421810 missense probably damaging 1.00
R3874:Rims1 UTSW 1 22428489 missense probably damaging 1.00
R3901:Rims1 UTSW 1 22533497 missense probably benign 0.00
R3964:Rims1 UTSW 1 22427459 splice site probably null
R4037:Rims1 UTSW 1 22475712 missense probably damaging 0.96
R4039:Rims1 UTSW 1 22475712 missense probably damaging 0.96
R4056:Rims1 UTSW 1 22292939 splice site probably benign
R4062:Rims1 UTSW 1 22533583 missense probably benign 0.00
R4552:Rims1 UTSW 1 22373494 missense probably damaging 0.99
R4658:Rims1 UTSW 1 22427543 missense probably damaging 0.98
R4688:Rims1 UTSW 1 22479447 nonsense probably null
R4696:Rims1 UTSW 1 22288612 missense probably damaging 1.00
R4720:Rims1 UTSW 1 22427481 missense probably damaging 1.00
R4764:Rims1 UTSW 1 22479462 missense probably damaging 1.00
R4780:Rims1 UTSW 1 22291105 missense probably damaging 1.00
R4931:Rims1 UTSW 1 22533947 missense probably benign 0.26
R5137:Rims1 UTSW 1 22288620 nonsense probably null
R5153:Rims1 UTSW 1 22483247 nonsense probably null
R5305:Rims1 UTSW 1 22596542 missense probably damaging 0.99
R5354:Rims1 UTSW 1 22538511 missense probably damaging 1.00
R5386:Rims1 UTSW 1 22412245 missense probably damaging 0.99
R5485:Rims1 UTSW 1 22483208 missense possibly damaging 0.93
R5643:Rims1 UTSW 1 22538509 missense probably damaging 1.00
R5929:Rims1 UTSW 1 22468241 missense probably damaging 1.00
R5988:Rims1 UTSW 1 22596463 missense probably damaging 1.00
R6579:Rims1 UTSW 1 22425916 missense probably damaging 1.00
R6790:Rims1 UTSW 1 22468197 missense probably damaging 1.00
R7048:Rims1 UTSW 1 22472820 missense probably damaging 1.00
R7100:Rims1 UTSW 1 22346473 missense probably benign 0.27
R7155:Rims1 UTSW 1 22432923 missense probably damaging 0.99
R7171:Rims1 UTSW 1 22428489 missense
R7448:Rims1 UTSW 1 22404475 missense
Z1088:Rims1 UTSW 1 22288586 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACCATGCCTTTCACCACG -3'
(R):5'- TGAGCTTATCCTCTTCCATACAGG -3'

Sequencing Primer
(F):5'- TTTCACCACGCACCTGGAG -3'
(R):5'- CAGGATGAATTGTAGGTACTTCAC -3'
Posted On2017-10-10