Incidental Mutation 'R6160:Rfc4'
List |< first << previous [record 52 of 67] next >> last >|
ID489836
Institutional Source Beutler Lab
Gene Symbol Rfc4
Ensembl Gene ENSMUSG00000022881
Gene Namereplication factor C (activator 1) 4
SynonymsA1, RFC37
MMRRC Submission 044307-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R6160 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location23113943-23127737 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 23114683 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 242 (I242N)
Ref Sequence ENSEMBL: ENSMUSP00000110995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023598] [ENSMUST00000023599] [ENSMUST00000077605] [ENSMUST00000115337] [ENSMUST00000115338] [ENSMUST00000115341] [ENSMUST00000123413] [ENSMUST00000131871] [ENSMUST00000133847] [ENSMUST00000147117] [ENSMUST00000168891] [ENSMUST00000187168] [ENSMUST00000232287]
Predicted Effect probably damaging
Transcript: ENSMUST00000023598
AA Change: I242N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023598
Gene: ENSMUSG00000022881
AA Change: I242N

DomainStartEndE-ValueType
AAA 70 202 5.8e-13 SMART
Pfam:Rep_fac_C 267 356 2.2e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000023599
SMART Domains Protein: ENSMUSP00000023599
Gene: ENSMUSG00000022884

DomainStartEndE-ValueType
DEXDc 52 250 4.62e-58 SMART
HELICc 287 368 5.21e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000077605
SMART Domains Protein: ENSMUSP00000090876
Gene: ENSMUSG00000022884

DomainStartEndE-ValueType
DEXDc 52 250 4.62e-58 SMART
HELICc 287 362 1.86e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082448
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082946
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083274
Predicted Effect probably benign
Transcript: ENSMUST00000115337
SMART Domains Protein: ENSMUSP00000110994
Gene: ENSMUSG00000022881

DomainStartEndE-ValueType
SCOP:d1iqpa2 29 67 2e-5 SMART
PDB:1SXJ|D 39 76 4e-8 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000115338
AA Change: I242N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110995
Gene: ENSMUSG00000022881
AA Change: I242N

DomainStartEndE-ValueType
AAA 70 202 5.8e-13 SMART
Pfam:Rep_fac_C 269 344 3.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115341
SMART Domains Protein: ENSMUSP00000110998
Gene: ENSMUSG00000022884

DomainStartEndE-ValueType
DEXDc 53 251 4.62e-58 SMART
HELICc 288 369 5.21e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123413
SMART Domains Protein: ENSMUSP00000115649
Gene: ENSMUSG00000022884

DomainStartEndE-ValueType
DEXDc 52 250 4.62e-58 SMART
HELICc 287 362 1.86e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125553
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125969
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130113
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130483
Predicted Effect probably benign
Transcript: ENSMUST00000131871
SMART Domains Protein: ENSMUSP00000118141
Gene: ENSMUSG00000022884

DomainStartEndE-ValueType
PDB:3EIQ|D 4 70 2e-33 PDB
Blast:DEXDc 17 73 3e-25 BLAST
SCOP:d1qdea_ 25 71 2e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133847
SMART Domains Protein: ENSMUSP00000115479
Gene: ENSMUSG00000022881

DomainStartEndE-ValueType
Pfam:Rad17 32 97 3.7e-9 PFAM
Pfam:AAA 74 98 2.4e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140017
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142031
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144493
Predicted Effect probably benign
Transcript: ENSMUST00000147117
SMART Domains Protein: ENSMUSP00000121745
Gene: ENSMUSG00000022884

DomainStartEndE-ValueType
PDB:3EIQ|D 4 69 4e-33 PDB
Blast:DEXDc 16 72 3e-25 BLAST
SCOP:d1qdea_ 24 70 2e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147321
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148085
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150117
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152129
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156227
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157310
Predicted Effect probably benign
Transcript: ENSMUST00000168891
SMART Domains Protein: ENSMUSP00000127030
Gene: ENSMUSG00000022884

DomainStartEndE-ValueType
DEXDc 1 155 1.92e-14 SMART
HELICc 192 273 5.21e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187168
SMART Domains Protein: ENSMUSP00000140809
Gene: ENSMUSG00000022884

DomainStartEndE-ValueType
DEXDc 52 250 4.62e-58 SMART
HELICc 287 362 1.86e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197708
Predicted Effect probably benign
Transcript: ENSMUST00000232287
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 94% (62/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The elongation of primed DNA templates by DNA polymerase delta and DNA polymerase epsilon requires the accessory proteins proliferating cell nuclear antigen (PCNA) and replication factor C (RFC). RFC, also named activator 1, is a protein complex consisting of five distinct subunits of 140, 40, 38, 37, and 36 kD. This gene encodes the 37 kD subunit. This subunit forms a core complex with the 36 and 40 kDa subunits. The core complex possesses DNA-dependent ATPase activity, which was found to be stimulated by PCNA in an in vitro system. Alternatively spliced transcript variants encoding the same protein have been reported. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik G A 6: 149,331,507 probably null Het
4930433I11Rik T A 7: 40,993,526 S297R possibly damaging Het
5530400C23Rik A G 6: 133,294,326 E111G possibly damaging Het
8030423J24Rik T A 13: 70,883,910 S34T unknown Het
Ace3 T A 11: 105,994,732 W20R possibly damaging Het
Adgrf1 A G 17: 43,310,687 E605G probably damaging Het
Arhgap44 G A 11: 65,162,549 probably benign Het
Atm A C 9: 53,490,959 H1404Q probably benign Het
AW209491 A G 13: 14,636,721 E53G probably damaging Het
Cdt1 C T 8: 122,571,368 T366I probably benign Het
Cerk A T 15: 86,142,773 C179S probably benign Het
Cldn10 T C 14: 118,861,843 V123A possibly damaging Het
Clip1 T C 5: 123,613,541 K726E possibly damaging Het
Dcaf12 A T 4: 41,294,043 Y365N probably damaging Het
Dennd6b A G 15: 89,188,821 L171P probably damaging Het
Dip2c G A 13: 9,533,254 V91I probably benign Het
Dlec1 A G 9: 119,143,319 I1431V probably benign Het
Egln1 T C 8: 124,948,492 D188G probably damaging Het
Enpp5 T A 17: 44,081,368 N229K possibly damaging Het
Fmo1 T G 1: 162,836,298 I221L probably benign Het
Fsip2 G A 2: 82,987,945 W4674* probably null Het
Gm12185 G A 11: 48,908,428 Q413* probably null Het
Gm5096 G A 18: 87,757,121 C256Y probably damaging Het
Gm7298 A T 6: 121,764,927 H436L probably benign Het
Gucy2c G A 6: 136,740,686 Q430* probably null Het
Hgd A G 16: 37,613,298 H134R probably damaging Het
Hoxd8 A G 2: 74,705,999 E151G probably damaging Het
Il15ra A G 2: 11,720,016 D99G probably damaging Het
Ints4 T A 7: 97,509,583 probably null Het
Itgb1 T A 8: 128,720,283 F426L possibly damaging Het
Itpr1 A C 6: 108,518,755 I2534L probably benign Het
Kcnq4 T A 4: 120,716,559 H235L probably damaging Het
Kcnt1 T A 2: 25,892,383 I178N probably damaging Het
Kidins220 A G 12: 24,997,311 D252G probably damaging Het
Krt23 A G 11: 99,485,718 I204T probably damaging Het
Lipo4 A G 19: 33,503,293 L225P probably damaging Het
Lrp3 T C 7: 35,204,123 D245G possibly damaging Het
Mmp16 A G 4: 18,051,857 D282G probably damaging Het
Myo1c A T 11: 75,650,742 H18L probably benign Het
Myo1f C A 17: 33,604,344 P981Q probably benign Het
Nle1 A T 11: 82,908,157 F33I probably benign Het
Nlrp4e T G 7: 23,321,306 M406R probably damaging Het
Obscn A T 11: 59,051,785 V4857E probably damaging Het
Palb2 A T 7: 122,128,420 probably null Het
Phospho1 A T 11: 95,830,624 E22V probably damaging Het
Pom121l2 C T 13: 21,983,668 S703L possibly damaging Het
Prex2 T C 1: 10,993,851 L20P probably damaging Het
Psmb7 T C 2: 38,643,381 T45A probably damaging Het
R3hdm2 T C 10: 127,484,507 I532T probably damaging Het
Rcn1 T C 2: 105,392,017 D208G probably damaging Het
Recql5 A G 11: 115,932,787 probably null Het
Rims1 T C 1: 22,432,984 Y650C probably damaging Het
Shc2 C T 10: 79,627,019 probably null Het
Slc14a2 A T 18: 78,158,975 probably null Het
Slc6a6 A T 6: 91,740,014 probably null Het
Synj2 C A 17: 6,008,061 H275N possibly damaging Het
T A T 17: 8,441,786 T410S probably benign Het
Tarsl2 A G 7: 65,682,779 I543V probably benign Het
Tbc1d8 T A 1: 39,372,403 K1117N probably damaging Het
Tm7sf3 A T 6: 146,606,289 L425* probably null Het
Trav14-3 A G 14: 53,763,521 Y63C probably damaging Het
Tyro3 A C 2: 119,803,270 D133A probably damaging Het
Vmn1r119 T G 7: 21,011,815 H214P possibly damaging Het
Vmn2r120 G A 17: 57,509,418 P646S probably benign Het
Zbtb7c A T 18: 76,145,833 Y454F probably benign Het
Zmym2 T C 14: 56,950,309 L1144P probably damaging Het
Other mutations in Rfc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01135:Rfc4 APN 16 23115776 missense probably damaging 1.00
IGL01625:Rfc4 APN 16 23115823 missense probably damaging 1.00
IGL02238:Rfc4 APN 16 23114469 missense probably damaging 0.99
IGL02693:Rfc4 APN 16 23114210 missense probably damaging 1.00
R6409_Rfc4_790 UTSW 16 23114073 makesense probably null
R0094:Rfc4 UTSW 16 23115428 missense probably benign 0.03
R0230:Rfc4 UTSW 16 23114099 nonsense probably null
R1493:Rfc4 UTSW 16 23118008 missense probably damaging 1.00
R1699:Rfc4 UTSW 16 23114233 missense probably benign 0.00
R2119:Rfc4 UTSW 16 23124564 missense probably damaging 1.00
R2194:Rfc4 UTSW 16 23114152 unclassified probably benign
R4575:Rfc4 UTSW 16 23114429 unclassified probably benign
R5097:Rfc4 UTSW 16 23114296 missense possibly damaging 0.82
R5495:Rfc4 UTSW 16 23122254 intron probably benign
R6118:Rfc4 UTSW 16 23120943 missense probably damaging 1.00
R6232:Rfc4 UTSW 16 23114090 unclassified probably benign
R6281:Rfc4 UTSW 16 23118066 splice site probably null
R6310:Rfc4 UTSW 16 23114709 missense probably benign 0.37
R6409:Rfc4 UTSW 16 23114073 makesense probably null
R6411:Rfc4 UTSW 16 23114073 makesense probably null
R7161:Rfc4 UTSW 16 23115433 missense probably benign 0.03
R7202:Rfc4 UTSW 16 23127609 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AAAAGAGCCACTGTGACATGC -3'
(R):5'- AAGACTCCACACATGCATTATTGTG -3'

Sequencing Primer
(F):5'- CCATCAATGGTTGCAGCTG -3'
(R):5'- CTCCACACATGCATTATTGTGAATTC -3'
Posted On2017-10-10