Incidental Mutation 'R6160:Hgd'
List |< first << previous [record 26 of 67] next >> last >|
ID489837
Institutional Source Beutler Lab
Gene Symbol Hgd
Ensembl Gene ENSMUSG00000022821
Gene Namehomogentisate 1, 2-dioxygenase
Synonyms
MMRRC Submission 044307-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6160 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location37580153-37632020 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37613298 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 134 (H134R)
Ref Sequence ENSEMBL: ENSMUSP00000125492 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159787] [ENSMUST00000160847]
Predicted Effect probably damaging
Transcript: ENSMUST00000159787
AA Change: H93R

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000160847
AA Change: H134R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125492
Gene: ENSMUSG00000022821
AA Change: H134R

DomainStartEndE-ValueType
Pfam:HgmA 5 434 2e-225 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161193
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162918
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 94% (62/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the enzyme homogentisate 1,2 dioxygenase. This enzyme is involved in the catabolism of the amino acids tyrosine and phenylalanine. Mutations in this gene are the cause of the autosomal recessive metabolism disorder alkaptonuria.[provided by RefSeq, May 2010]
PHENOTYPE: Mutations in this gene result in high levels of urinary homogentisic acid. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik G A 6: 149,331,507 probably null Het
4930433I11Rik T A 7: 40,993,526 S297R possibly damaging Het
5530400C23Rik A G 6: 133,294,326 E111G possibly damaging Het
8030423J24Rik T A 13: 70,883,910 S34T unknown Het
Ace3 T A 11: 105,994,732 W20R possibly damaging Het
Adgrf1 A G 17: 43,310,687 E605G probably damaging Het
Arhgap44 G A 11: 65,162,549 probably benign Het
Atm A C 9: 53,490,959 H1404Q probably benign Het
AW209491 A G 13: 14,636,721 E53G probably damaging Het
Cdt1 C T 8: 122,571,368 T366I probably benign Het
Cerk A T 15: 86,142,773 C179S probably benign Het
Cldn10 T C 14: 118,861,843 V123A possibly damaging Het
Clip1 T C 5: 123,613,541 K726E possibly damaging Het
Dcaf12 A T 4: 41,294,043 Y365N probably damaging Het
Dennd6b A G 15: 89,188,821 L171P probably damaging Het
Dip2c G A 13: 9,533,254 V91I probably benign Het
Dlec1 A G 9: 119,143,319 I1431V probably benign Het
Egln1 T C 8: 124,948,492 D188G probably damaging Het
Enpp5 T A 17: 44,081,368 N229K possibly damaging Het
Fmo1 T G 1: 162,836,298 I221L probably benign Het
Fsip2 G A 2: 82,987,945 W4674* probably null Het
Gm12185 G A 11: 48,908,428 Q413* probably null Het
Gm5096 G A 18: 87,757,121 C256Y probably damaging Het
Gm7298 A T 6: 121,764,927 H436L probably benign Het
Gucy2c G A 6: 136,740,686 Q430* probably null Het
Hoxd8 A G 2: 74,705,999 E151G probably damaging Het
Il15ra A G 2: 11,720,016 D99G probably damaging Het
Ints4 T A 7: 97,509,583 probably null Het
Itgb1 T A 8: 128,720,283 F426L possibly damaging Het
Itpr1 A C 6: 108,518,755 I2534L probably benign Het
Kcnq4 T A 4: 120,716,559 H235L probably damaging Het
Kcnt1 T A 2: 25,892,383 I178N probably damaging Het
Kidins220 A G 12: 24,997,311 D252G probably damaging Het
Krt23 A G 11: 99,485,718 I204T probably damaging Het
Lipo4 A G 19: 33,503,293 L225P probably damaging Het
Lrp3 T C 7: 35,204,123 D245G possibly damaging Het
Mmp16 A G 4: 18,051,857 D282G probably damaging Het
Myo1c A T 11: 75,650,742 H18L probably benign Het
Myo1f C A 17: 33,604,344 P981Q probably benign Het
Nle1 A T 11: 82,908,157 F33I probably benign Het
Nlrp4e T G 7: 23,321,306 M406R probably damaging Het
Obscn A T 11: 59,051,785 V4857E probably damaging Het
Palb2 A T 7: 122,128,420 probably null Het
Phospho1 A T 11: 95,830,624 E22V probably damaging Het
Pom121l2 C T 13: 21,983,668 S703L possibly damaging Het
Prex2 T C 1: 10,993,851 L20P probably damaging Het
Psmb7 T C 2: 38,643,381 T45A probably damaging Het
R3hdm2 T C 10: 127,484,507 I532T probably damaging Het
Rcn1 T C 2: 105,392,017 D208G probably damaging Het
Recql5 A G 11: 115,932,787 probably null Het
Rfc4 A T 16: 23,114,683 I242N probably damaging Het
Rims1 T C 1: 22,432,984 Y650C probably damaging Het
Shc2 C T 10: 79,627,019 probably null Het
Slc14a2 A T 18: 78,158,975 probably null Het
Slc6a6 A T 6: 91,740,014 probably null Het
Synj2 C A 17: 6,008,061 H275N possibly damaging Het
T A T 17: 8,441,786 T410S probably benign Het
Tarsl2 A G 7: 65,682,779 I543V probably benign Het
Tbc1d8 T A 1: 39,372,403 K1117N probably damaging Het
Tm7sf3 A T 6: 146,606,289 L425* probably null Het
Trav14-3 A G 14: 53,763,521 Y63C probably damaging Het
Tyro3 A C 2: 119,803,270 D133A probably damaging Het
Vmn1r119 T G 7: 21,011,815 H214P possibly damaging Het
Vmn2r120 G A 17: 57,509,418 P646S probably benign Het
Zbtb7c A T 18: 76,145,833 Y454F probably benign Het
Zmym2 T C 14: 56,950,309 L1144P probably damaging Het
Other mutations in Hgd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Hgd APN 16 37613249 missense probably damaging 1.00
IGL00851:Hgd APN 16 37631695 missense probably damaging 0.98
IGL01339:Hgd APN 16 37631730 missense possibly damaging 0.72
IGL01627:Hgd APN 16 37621925 missense probably damaging 0.96
IGL02565:Hgd APN 16 37615387 missense possibly damaging 0.88
IGL03098:Hgd UTSW 16 37616245 missense probably benign 0.44
R0346:Hgd UTSW 16 37588774 splice site probably benign
R0360:Hgd UTSW 16 37611184 splice site probably benign
R0426:Hgd UTSW 16 37588685 splice site probably benign
R0799:Hgd UTSW 16 37628609 splice site probably benign
R1178:Hgd UTSW 16 37615394 missense possibly damaging 0.95
R2921:Hgd UTSW 16 37618968 missense probably damaging 1.00
R2922:Hgd UTSW 16 37618968 missense probably damaging 1.00
R4791:Hgd UTSW 16 37631825 makesense probably null
R4859:Hgd UTSW 16 37588749 missense probably damaging 1.00
R5289:Hgd UTSW 16 37628551 missense possibly damaging 0.94
R5368:Hgd UTSW 16 37589751 missense probably benign 0.33
R5779:Hgd UTSW 16 37593371 missense probably benign 0.01
R6140:Hgd UTSW 16 37589713 missense probably benign 0.04
R6636:Hgd UTSW 16 37615374 missense possibly damaging 0.75
R7196:Hgd UTSW 16 37588716 missense probably benign 0.03
R7450:Hgd UTSW 16 37624324 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TGATCCCAAATGGCCCCTAG -3'
(R):5'- TTCGTCACAAGGCCCTAAC -3'

Sequencing Primer
(F):5'- CCTAGGGCATTCTCAAAGGG -3'
(R):5'- GAGTACAATGTCGCTGTCTTCAGAC -3'
Posted On2017-10-10