Incidental Mutation 'R6161:Stat4'
ID489850
Institutional Source Beutler Lab
Gene Symbol Stat4
Ensembl Gene ENSMUSG00000062939
Gene Namesignal transducer and activator of transcription 4
Synonyms
MMRRC Submission 044308-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.466) question?
Stock #R6161 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location51987148-52107189 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 52074677 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 182 (D182V)
Ref Sequence ENSEMBL: ENSMUSP00000130713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027277] [ENSMUST00000168302]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027277
AA Change: D182V

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000027277
Gene: ENSMUSG00000062939
AA Change: D182V

DomainStartEndE-ValueType
STAT_int 2 122 3.73e-60 SMART
Pfam:STAT_alpha 140 314 2.2e-54 PFAM
Pfam:STAT_bind 316 562 4.7e-76 PFAM
SH2 571 681 9.07e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000168302
AA Change: D182V

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000130713
Gene: ENSMUSG00000062939
AA Change: D182V

DomainStartEndE-ValueType
STAT_int 2 122 3.73e-60 SMART
Pfam:STAT_alpha 137 314 8.2e-66 PFAM
Pfam:STAT_bind 316 563 3.3e-114 PFAM
SH2 571 681 9.07e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185516
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187053
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.9%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the STAT family of transcription factors. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. Homozygous knockout mice for this gene exhibit reduced inflammation and cytokine production in response to immune challenge. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous inactivation of this gene leads to altered cytokine production of T-cells, impaired IL-12 responses, enhanced Th2 cell development, decreased susceptibility to autoimmune diabetes, altered NK cell responses during viral infection, and increased susceptibility to Salmonella infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,540,711 K1533M probably damaging Het
Aldh1l2 C T 10: 83,520,338 V63I probably benign Het
Atr A G 9: 95,865,319 H218R probably benign Het
Atxn7l1 T A 12: 33,358,663 S275T possibly damaging Het
Cacna1c T C 6: 119,057,302 K88R probably damaging Het
Ccl7 T C 11: 82,046,586 Y49H probably damaging Het
Cd3eap G A 7: 19,357,633 T183I possibly damaging Het
Cers5 A G 15: 99,738,663 probably null Het
Chuk T C 19: 44,082,637 E543G probably damaging Het
Dip2c T C 13: 9,647,007 V1318A probably damaging Het
Ercc5 A G 1: 44,167,352 H475R probably benign Het
Fat3 A G 9: 16,377,522 L235P probably damaging Het
Fbn1 A T 2: 125,369,801 C892* probably null Het
Fbxw8 T C 5: 118,092,675 T354A possibly damaging Het
Fsip2 A C 2: 82,987,257 T4445P possibly damaging Het
Gpld1 A T 13: 24,971,414 Q344L probably benign Het
Hao1 A T 2: 134,505,625 D253E probably benign Het
Hmcn2 A G 2: 31,356,254 D745G probably benign Het
Kcnt1 A G 2: 25,903,385 T658A probably benign Het
Klhl35 A G 7: 99,473,337 probably benign Het
Lnx2 C T 5: 147,042,026 probably null Het
Map3k5 T C 10: 20,000,575 V160A probably damaging Het
Masp2 A T 4: 148,614,012 I517F possibly damaging Het
Mc4r A T 18: 66,859,180 Y287* probably null Het
Mthfr A G 4: 148,041,754 D94G probably benign Het
Muc16 A G 9: 18,647,818 I2393T unknown Het
Mybbp1a G T 11: 72,446,012 V557L probably damaging Het
Mycbp2 A T 14: 103,298,747 W256R probably damaging Het
Nacad G A 11: 6,600,902 S763L probably benign Het
Nebl A G 2: 17,730,830 V11A probably benign Het
Notch1 A T 2: 26,468,731 C1363S probably damaging Het
Nphp3 A G 9: 104,031,906 N772D probably benign Het
Nqo2 G A 13: 33,979,651 V98M probably damaging Het
Pak4 A G 7: 28,565,267 I70T possibly damaging Het
Pbx2 A G 17: 34,593,600 K2E probably damaging Het
Pikfyve A G 1: 65,216,043 T352A probably benign Het
Pop1 T C 15: 34,526,310 Y684H probably damaging Het
Rpa1 A G 11: 75,314,895 V212A probably damaging Het
Rpap2 A G 5: 107,620,670 E458G probably damaging Het
Sin3a T C 9: 57,095,424 V200A possibly damaging Het
Sla T C 15: 66,782,598 T280A probably null Het
Slc22a26 A T 19: 7,786,447 I406K possibly damaging Het
Slc24a1 T C 9: 64,937,263 N606S unknown Het
Slc39a10 G A 1: 46,827,407 T443M probably damaging Het
Smg1 A T 7: 118,163,330 probably benign Het
Sra1 G A 18: 36,670,283 A9V probably damaging Het
Stard4 A G 18: 33,209,056 V47A probably damaging Het
Syt1 A G 10: 108,631,807 F210L probably damaging Het
Ube2q1 T A 3: 89,781,360 probably null Het
Vmn1r159 C T 7: 22,843,187 C140Y possibly damaging Het
Wnt8a T C 18: 34,545,546 F138L possibly damaging Het
Zfp623 T A 15: 75,948,621 D475E probably benign Het
Zfp646 C T 7: 127,878,725 R25W probably damaging Het
Other mutations in Stat4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Stat4 APN 1 52102878 missense probably damaging 1.00
IGL00482:Stat4 APN 1 52074697 missense probably benign 0.05
IGL01395:Stat4 APN 1 52011874 missense probably damaging 1.00
IGL01533:Stat4 APN 1 52098419 missense probably damaging 1.00
IGL01943:Stat4 APN 1 52096855 missense possibly damaging 0.94
IGL02114:Stat4 APN 1 52102865 missense probably damaging 1.00
IGL02151:Stat4 APN 1 52013870 missense probably damaging 0.99
IGL02601:Stat4 APN 1 52098415 missense probably damaging 1.00
R0016:Stat4 UTSW 1 52068780 missense probably benign 0.01
R0243:Stat4 UTSW 1 52011857 missense probably benign 0.22
R0329:Stat4 UTSW 1 52090870 intron probably benign
R0973:Stat4 UTSW 1 52096820 missense probably damaging 0.99
R1144:Stat4 UTSW 1 52084129 splice site probably benign
R1187:Stat4 UTSW 1 52076677 missense probably damaging 1.00
R1331:Stat4 UTSW 1 52013927 missense probably benign 0.20
R1401:Stat4 UTSW 1 52071947 splice site probably benign
R1529:Stat4 UTSW 1 52011793 missense probably damaging 1.00
R1711:Stat4 UTSW 1 52106925 missense probably damaging 1.00
R2213:Stat4 UTSW 1 52013855 missense probably damaging 0.98
R3003:Stat4 UTSW 1 52102986 missense probably damaging 1.00
R3683:Stat4 UTSW 1 52013822 missense possibly damaging 0.89
R3789:Stat4 UTSW 1 52011796 missense probably benign 0.07
R3919:Stat4 UTSW 1 52096822 missense possibly damaging 0.62
R4320:Stat4 UTSW 1 52074707 missense probably benign
R4373:Stat4 UTSW 1 52071941 critical splice donor site probably null
R5024:Stat4 UTSW 1 52082570 missense possibly damaging 0.80
R5103:Stat4 UTSW 1 52071895 missense probably damaging 0.97
R5206:Stat4 UTSW 1 52105236 missense probably damaging 0.99
R5944:Stat4 UTSW 1 52074739 missense probably damaging 1.00
R5961:Stat4 UTSW 1 52065384 missense possibly damaging 0.50
R6001:Stat4 UTSW 1 52096867 missense probably damaging 0.96
R6262:Stat4 UTSW 1 52102201 missense probably null 1.00
R6701:Stat4 UTSW 1 52102974 missense probably damaging 1.00
R6767:Stat4 UTSW 1 52076583 missense probably benign 0.00
R6989:Stat4 UTSW 1 52068815 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CCTGGCAAAACAAGGACATTCG -3'
(R):5'- TTTACCCAGAGACATGGAGGAC -3'

Sequencing Primer
(F):5'- ACATTCGTGGACTGGGCTTCC -3'
(R):5'- GGACAATTCCTGGAAATTCTGAC -3'
Posted On2017-10-10