Incidental Mutation 'R6162:Vmn2r12'
ID489916
Institutional Source Beutler Lab
Gene Symbol Vmn2r12
Ensembl Gene ENSMUSG00000090688
Gene Namevomeronasal 2, receptor 12
SynonymsGm6769
MMRRC Submission 044309-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R6162 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location109085849-109097864 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 109086564 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 594 (L594P)
Ref Sequence ENSEMBL: ENSMUSP00000093612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095922]
Predicted Effect probably damaging
Transcript: ENSMUST00000095922
AA Change: L594P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000093612
Gene: ENSMUSG00000090688
AA Change: L594P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 76 466 8.8e-30 PFAM
Pfam:NCD3G 505 559 1.7e-18 PFAM
Pfam:7tm_3 591 827 3.9e-54 PFAM
Meta Mutation Damage Score 0.0264 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T G 11: 9,309,047 C2924W probably damaging Het
Adh4 T A 3: 138,415,489 probably null Het
AI464131 A G 4: 41,497,899 V577A possibly damaging Het
Aox3 A T 1: 58,159,731 D695V possibly damaging Het
Ccnj A G 19: 40,845,162 Y221C probably damaging Het
Cct2 T A 10: 117,058,186 D221V probably damaging Het
Cd5 G A 19: 10,725,880 T138M probably damaging Het
Cep78 A T 19: 15,974,940 M307K probably benign Het
Dclk1 C A 3: 55,256,154 D222E probably benign Het
Dhrs11 C T 11: 84,828,779 G40D probably damaging Het
Dnah10 A G 5: 124,823,318 S3823G probably benign Het
Dock3 A T 9: 106,964,799 Y944N possibly damaging Het
Dst A G 1: 34,006,237 D17G probably damaging Het
Ehmt2 C T 17: 34,899,091 R40* probably null Het
Fam20a G T 11: 109,682,870 S229* probably null Het
Fbn1 T C 2: 125,360,227 D1242G probably damaging Het
Ggt5 T A 10: 75,589,792 V28D possibly damaging Het
Gimap4 A T 6: 48,690,721 I137F probably damaging Het
Git2 T A 5: 114,761,656 H212L probably damaging Het
Gprc6a T A 10: 51,614,912 I739F probably benign Het
Il1rl2 A G 1: 40,351,878 Y327C probably damaging Het
Lmf1 A G 17: 25,612,394 I205V probably benign Het
Mipep C A 14: 60,787,404 P98Q probably damaging Het
Mroh2b A G 15: 4,915,225 D436G probably damaging Het
Notch1 C T 2: 26,462,195 V2035I probably benign Het
Olfr1223 G T 2: 89,144,770 F84L probably benign Het
Olfr388-ps1 T A 11: 73,724,887 I46F probably damaging Het
Olfr698 A T 7: 106,753,020 Y123N probably damaging Het
Oxa1l A G 14: 54,368,332 T395A probably damaging Het
Phospho2 T A 2: 69,796,031 I177K probably damaging Het
Prpf40a T C 2: 53,159,305 T224A probably benign Het
Reln T A 5: 21,911,050 T2987S probably damaging Het
Scn5a T A 9: 119,522,555 I787F probably damaging Het
Sgsm2 A T 11: 74,892,021 D36E probably damaging Het
Slc12a3 A G 8: 94,345,773 probably null Het
Soga1 T A 2: 157,039,864 E756V possibly damaging Het
Tas2r134 T C 2: 51,627,559 S17P probably damaging Het
Top3a T C 11: 60,745,937 Y609C probably damaging Het
Trem2 A G 17: 48,348,666 I84V probably damaging Het
Wdr63 T A 3: 146,044,862 I821F probably damaging Het
Zdbf2 A T 1: 63,280,818 probably benign Het
Zfr C T 15: 12,146,245 A294V unknown Het
Other mutations in Vmn2r12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00948:Vmn2r12 APN 5 109097675 missense possibly damaging 0.47
IGL01096:Vmn2r12 APN 5 109086259 missense probably damaging 1.00
IGL01538:Vmn2r12 APN 5 109091850 missense probably damaging 1.00
IGL01548:Vmn2r12 APN 5 109093027 nonsense probably null
IGL01762:Vmn2r12 APN 5 109086564 missense probably damaging 0.99
IGL01860:Vmn2r12 APN 5 109092159 missense probably benign 0.10
IGL02269:Vmn2r12 APN 5 109086477 missense probably damaging 1.00
IGL02530:Vmn2r12 APN 5 109085992 missense probably damaging 1.00
IGL02887:Vmn2r12 APN 5 109090485 missense probably benign 0.03
IGL03265:Vmn2r12 APN 5 109092070 missense probably benign 0.05
R0396:Vmn2r12 UTSW 5 109092899 missense probably benign 0.00
R0497:Vmn2r12 UTSW 5 109091889 nonsense probably null
R0529:Vmn2r12 UTSW 5 109092848 missense probably benign
R0715:Vmn2r12 UTSW 5 109090507 missense probably benign 0.10
R0742:Vmn2r12 UTSW 5 109086415 missense possibly damaging 0.55
R0894:Vmn2r12 UTSW 5 109087850 critical splice donor site probably null
R1173:Vmn2r12 UTSW 5 109092854 missense probably benign 0.00
R1174:Vmn2r12 UTSW 5 109092854 missense probably benign 0.00
R1259:Vmn2r12 UTSW 5 109091897 missense probably damaging 0.97
R1349:Vmn2r12 UTSW 5 109086586 missense probably benign 0.00
R1388:Vmn2r12 UTSW 5 109092974 missense possibly damaging 0.56
R1549:Vmn2r12 UTSW 5 109092830 missense probably benign 0.06
R1766:Vmn2r12 UTSW 5 109092044 missense probably damaging 1.00
R1781:Vmn2r12 UTSW 5 109091728 missense probably benign 0.00
R1885:Vmn2r12 UTSW 5 109092076 missense probably damaging 1.00
R2159:Vmn2r12 UTSW 5 109091474 missense probably benign 0.02
R2420:Vmn2r12 UTSW 5 109086532 missense probably benign 0.39
R2421:Vmn2r12 UTSW 5 109086532 missense probably benign 0.39
R2422:Vmn2r12 UTSW 5 109086532 missense probably benign 0.39
R2937:Vmn2r12 UTSW 5 109091531 missense probably damaging 1.00
R2938:Vmn2r12 UTSW 5 109091531 missense probably damaging 1.00
R3898:Vmn2r12 UTSW 5 109090504 missense probably benign 0.02
R4061:Vmn2r12 UTSW 5 109092192 missense possibly damaging 0.95
R4063:Vmn2r12 UTSW 5 109092192 missense possibly damaging 0.95
R4090:Vmn2r12 UTSW 5 109091546 missense probably benign 0.06
R4297:Vmn2r12 UTSW 5 109091964 missense probably benign 0.12
R4298:Vmn2r12 UTSW 5 109091964 missense probably benign 0.12
R4299:Vmn2r12 UTSW 5 109091964 missense probably benign 0.12
R4304:Vmn2r12 UTSW 5 109086006 missense probably damaging 1.00
R4306:Vmn2r12 UTSW 5 109086006 missense probably damaging 1.00
R4307:Vmn2r12 UTSW 5 109086006 missense probably damaging 1.00
R4308:Vmn2r12 UTSW 5 109086006 missense probably damaging 1.00
R4594:Vmn2r12 UTSW 5 109086435 missense probably damaging 1.00
R4783:Vmn2r12 UTSW 5 109086513 missense probably damaging 1.00
R4900:Vmn2r12 UTSW 5 109092986 missense probably damaging 1.00
R4929:Vmn2r12 UTSW 5 109091678 missense probably damaging 1.00
R4974:Vmn2r12 UTSW 5 109091506 missense probably damaging 1.00
R5389:Vmn2r12 UTSW 5 109090395 missense probably benign 0.00
R5431:Vmn2r12 UTSW 5 109091818 missense probably damaging 0.99
R5527:Vmn2r12 UTSW 5 109086617 nonsense probably null
R5639:Vmn2r12 UTSW 5 109092800 missense probably benign 0.06
R5753:Vmn2r12 UTSW 5 109091804 missense probably damaging 1.00
R5797:Vmn2r12 UTSW 5 109085870 nonsense probably null
R6142:Vmn2r12 UTSW 5 109092897 missense probably benign
R6176:Vmn2r12 UTSW 5 109086000 missense probably benign 0.43
R6853:Vmn2r12 UTSW 5 109092905 missense probably damaging 1.00
R7238:Vmn2r12 UTSW 5 109097789 missense possibly damaging 0.81
R7341:Vmn2r12 UTSW 5 109086247 missense possibly damaging 0.74
R7341:Vmn2r12 UTSW 5 109091945 missense possibly damaging 0.95
R7383:Vmn2r12 UTSW 5 109092818 missense probably benign 0.19
Z1088:Vmn2r12 UTSW 5 109092780 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAAATGTGGTCTGCTGCAGG -3'
(R):5'- GGAATGGATTCTCGACATTTATCG -3'

Sequencing Primer
(F):5'- CAGGATGCAGGTGGCCAG -3'
(R):5'- TTAGAGAAAACCCACTGCC -3'
Posted On2017-10-10