Incidental Mutation 'R0528:Vmn2r76'
ID48993
Institutional Source Beutler Lab
Gene Symbol Vmn2r76
Ensembl Gene ENSMUSG00000091239
Gene Namevomeronasal 2, receptor 76
Synonyms
MMRRC Submission 038720-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.277) question?
Stock #R0528 (G1)
Quality Score176
Status Validated
Chromosome7
Chromosomal Location86225206-86246201 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86230298 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 265 (S265P)
Ref Sequence ENSEMBL: ENSMUSP00000127309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165771]
Predicted Effect possibly damaging
Transcript: ENSMUST00000165771
AA Change: S265P

PolyPhen 2 Score 0.803 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127309
Gene: ENSMUSG00000091239
AA Change: S265P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 78 470 1.2e-29 PFAM
low complexity region 476 489 N/A INTRINSIC
Pfam:NCD3G 513 565 3.7e-22 PFAM
Pfam:7tm_3 598 833 1.4e-52 PFAM
Meta Mutation Damage Score 0.0552 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.9%
Validation Efficiency 96% (65/68)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T G 10: 80,003,014 W674G probably damaging Het
Abcc9 G A 6: 142,692,880 H103Y probably damaging Het
Ano7 A G 1: 93,395,502 N495S probably null Het
Ash1l A G 3: 88,982,277 N488D probably benign Het
Astn2 A G 4: 65,644,882 probably benign Het
Atraid T A 5: 31,052,452 probably benign Het
Baz2b T C 2: 59,936,739 R866G probably damaging Het
Cep164 T A 9: 45,776,936 probably benign Het
Clec4f G A 6: 83,652,794 Q261* probably null Het
Cpne4 A T 9: 104,686,441 N6Y probably damaging Het
Dhx38 G T 8: 109,562,661 Q36K probably benign Het
Dna2 C A 10: 62,958,131 Q341K probably benign Het
Dynap A G 18: 70,242,094 probably benign Het
Eif3l T C 15: 79,089,609 V408A probably benign Het
Foxi3 T A 6: 70,957,138 I203N probably damaging Het
Gcc2 T A 10: 58,298,689 L1495Q probably damaging Het
Gpr158 A G 2: 21,825,208 D688G probably damaging Het
Hcfc2 C A 10: 82,739,245 T246K probably damaging Het
Hdc C T 2: 126,616,232 E57K probably benign Het
Iqsec3 G C 6: 121,412,784 probably benign Het
Islr2 T A 9: 58,199,362 E205V probably damaging Het
Klf9 T C 19: 23,142,134 L127P probably benign Het
Lamc2 A T 1: 153,124,094 L1173Q probably damaging Het
Lipe G A 7: 25,398,476 T14I possibly damaging Het
Lnpep A G 17: 17,531,132 probably benign Het
Lrrc15 A G 16: 30,273,748 S258P probably damaging Het
Macc1 A T 12: 119,447,045 Y516F probably benign Het
Megf6 A G 4: 154,259,173 T718A probably benign Het
Myh1 A G 11: 67,220,619 D1628G probably damaging Het
Naca C T 10: 128,043,293 T1398I probably benign Het
Olfr1366 A G 13: 21,537,246 F238S possibly damaging Het
Olfr441 A T 6: 43,116,216 H158L possibly damaging Het
Padi4 A G 4: 140,769,429 V52A possibly damaging Het
Paqr5 G A 9: 61,956,245 T251I probably damaging Het
Pcm1 A G 8: 41,315,930 D1611G probably damaging Het
Prss12 G A 3: 123,482,796 R358K probably benign Het
Racgap1 A T 15: 99,628,706 H325Q probably damaging Het
Rbm12b1 A G 4: 12,145,657 H543R probably benign Het
Rc3h1 A T 1: 160,967,658 N1076I probably damaging Het
Rp1 A G 1: 4,344,865 L2008P possibly damaging Het
Rsph3a A G 17: 7,946,087 H93R possibly damaging Het
Sbf1 C T 15: 89,288,712 R1840H probably damaging Het
Soga1 A G 2: 157,020,692 L1439P probably damaging Het
Svs1 T A 6: 48,988,031 D324E probably benign Het
Sytl2 T C 7: 90,403,020 probably benign Het
Tbc1d9 T C 8: 83,210,456 S56P probably damaging Het
Tiam2 A T 17: 3,511,071 M1304L probably damaging Het
Tmprss11b G T 5: 86,671,894 R9S probably damaging Het
Tnfrsf21 T A 17: 43,037,614 I39N probably benign Het
Tnrc6b T C 15: 80,879,403 S369P probably benign Het
Tpra1 T C 6: 88,910,390 V217A probably benign Het
Uckl1 G C 2: 181,570,490 probably benign Het
Vmn1r199 A T 13: 22,382,566 Q10L probably benign Het
Vwa5b1 A T 4: 138,594,351 L377Q probably damaging Het
Wdr61 T A 9: 54,722,935 probably benign Het
Wrap73 A G 4: 154,145,319 D49G probably damaging Het
Zfp764 T A 7: 127,404,879 Q360L possibly damaging Het
Zfp846 G A 9: 20,587,928 probably benign Het
Zranb2 T C 3: 157,534,459 I14T probably benign Het
Other mutations in Vmn2r76
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00969:Vmn2r76 APN 7 86228717 missense probably benign
IGL01374:Vmn2r76 APN 7 86225649 missense probably benign 0.02
IGL01419:Vmn2r76 APN 7 86225702 missense probably benign 0.32
IGL01627:Vmn2r76 APN 7 86225663 missense probably damaging 1.00
IGL01730:Vmn2r76 APN 7 86230198 missense probably benign 0.02
IGL01957:Vmn2r76 APN 7 86228717 missense probably benign
IGL02214:Vmn2r76 APN 7 86229930 missense probably benign 0.07
IGL02489:Vmn2r76 APN 7 86228863 missense probably benign 0.41
IGL02543:Vmn2r76 APN 7 86230148 missense probably benign 0.06
IGL02579:Vmn2r76 APN 7 86228753 nonsense probably null
IGL02598:Vmn2r76 APN 7 86228671 missense probably benign 0.05
IGL02720:Vmn2r76 APN 7 86225706 missense probably benign 0.35
IGL02745:Vmn2r76 APN 7 86230287 missense probably benign 0.06
IGL03393:Vmn2r76 APN 7 86229826 missense probably benign 0.01
R0483:Vmn2r76 UTSW 7 86225751 missense probably damaging 1.00
R0513:Vmn2r76 UTSW 7 86228779 missense probably benign 0.01
R0601:Vmn2r76 UTSW 7 86226115 critical splice acceptor site probably null
R0662:Vmn2r76 UTSW 7 86230370 missense probably benign 0.39
R0883:Vmn2r76 UTSW 7 86228696 missense probably benign 0.00
R1532:Vmn2r76 UTSW 7 86230246 missense probably benign 0.02
R1694:Vmn2r76 UTSW 7 86230148 missense probably benign 0.06
R1696:Vmn2r76 UTSW 7 86231256 missense possibly damaging 0.56
R2135:Vmn2r76 UTSW 7 86231011 missense probably benign 0.02
R2151:Vmn2r76 UTSW 7 86230484 missense probably benign
R2181:Vmn2r76 UTSW 7 86225535 missense probably benign 0.00
R2268:Vmn2r76 UTSW 7 86230499 missense probably benign 0.03
R2877:Vmn2r76 UTSW 7 86225993 missense probably benign 0.00
R3155:Vmn2r76 UTSW 7 86225751 missense probably damaging 1.00
R3746:Vmn2r76 UTSW 7 86225555 missense probably benign 0.11
R3799:Vmn2r76 UTSW 7 86226036 missense probably benign 0.00
R3825:Vmn2r76 UTSW 7 86231207 missense probably benign 0.10
R4058:Vmn2r76 UTSW 7 86230300 missense probably benign 0.00
R4237:Vmn2r76 UTSW 7 86230532 missense probably benign 0.00
R4404:Vmn2r76 UTSW 7 86228303 missense probably benign 0.16
R4796:Vmn2r76 UTSW 7 86230444 missense possibly damaging 0.95
R4838:Vmn2r76 UTSW 7 86225525 missense probably damaging 1.00
R5175:Vmn2r76 UTSW 7 86228707 missense probably benign 0.00
R5268:Vmn2r76 UTSW 7 86226059 missense probably damaging 1.00
R5381:Vmn2r76 UTSW 7 86225288 missense probably damaging 1.00
R5531:Vmn2r76 UTSW 7 86225449 missense probably damaging 1.00
R5566:Vmn2r76 UTSW 7 86226078 missense probably damaging 1.00
R5646:Vmn2r76 UTSW 7 86226053 missense probably damaging 0.98
R5664:Vmn2r76 UTSW 7 86245994 critical splice donor site probably null
R5818:Vmn2r76 UTSW 7 86229934 missense probably benign 0.00
R6093:Vmn2r76 UTSW 7 86228261 nonsense probably null
R6651:Vmn2r76 UTSW 7 86228851 missense possibly damaging 0.64
R6741:Vmn2r76 UTSW 7 86230352 missense probably benign
R6750:Vmn2r76 UTSW 7 86225906 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAATGGGCTACAGCATACACAGC -3'
(R):5'- AGATGACGGTCTAGGACTTCAATTTGC -3'

Sequencing Primer
(F):5'- CCAGCTATCTCAGAATAATGGTGTG -3'
(R):5'- CAATTTGCCTCTGAATTGAGAGAAG -3'
Posted On2013-06-12