Incidental Mutation 'R6163:Cenpe'
ID489951
Institutional Source Beutler Lab
Gene Symbol Cenpe
Ensembl Gene ENSMUSG00000045328
Gene Namecentromere protein E
Synonyms312kDa, CENP-E, Kif10, N-7 kinesin
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6163 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location135212537-135273611 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 135269003 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 2308 (I2308T)
Ref Sequence ENSEMBL: ENSMUSP00000057938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062893]
Predicted Effect probably damaging
Transcript: ENSMUST00000062893
AA Change: I2308T

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000057938
Gene: ENSMUSG00000045328
AA Change: I2308T

DomainStartEndE-ValueType
KISc 4 337 2.4e-172 SMART
coiled coil region 493 612 N/A INTRINSIC
coiled coil region 637 752 N/A INTRINSIC
internal_repeat_1 768 801 3.5e-5 PROSPERO
coiled coil region 821 991 N/A INTRINSIC
low complexity region 1119 1143 N/A INTRINSIC
internal_repeat_2 1225 1238 6.26e-5 PROSPERO
low complexity region 1446 1467 N/A INTRINSIC
low complexity region 1480 1498 N/A INTRINSIC
internal_repeat_2 1614 1627 6.26e-5 PROSPERO
internal_repeat_1 2018 2051 3.5e-5 PROSPERO
coiled coil region 2226 2247 N/A INTRINSIC
coiled coil region 2316 2363 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197273
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199497
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Centrosome-associated protein E (CENPE) is a kinesin-like motor protein that accumulates in the G2 phase of the cell cycle. Unlike other centrosome-associated proteins, it is not present during interphase and first appears at the centromere region of chromosomes during prometaphase. This protein is required for stable spindle microtubule capture at kinetochores which is a necessary step in chromosome alignment during prometaphase. This protein also couples chromosome position to microtubule depolymerizing activity. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for a knock-out allele display early embryonic lethality. Mutant embryos grown in culture exhibit inner cell mass growth defects and mitotic chromosome misalignment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik C T 5: 145,045,288 Q228* probably null Het
4922502D21Rik C T 6: 129,326,747 R85H probably benign Het
Asic5 A G 3: 82,006,526 N169S probably damaging Het
Atad2b T A 12: 4,954,593 L374H probably benign Het
BC080695 A G 4: 143,572,035 K183E probably damaging Het
Birc2 G A 9: 7,819,035 T544I probably benign Het
Blm GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCCTCCTCC 7: 80,512,904 probably benign Het
Cc2d2b C T 19: 40,756,506 T23I probably benign Het
Ccdc137 G T 11: 120,460,101 R108L possibly damaging Het
Cpt1b T C 15: 89,424,417 T103A probably benign Het
Cpvl C A 6: 53,873,518 V445F probably damaging Het
Cttnbp2 A G 6: 18,434,951 S303P possibly damaging Het
Cyp17a1 T A 19: 46,669,322 I264F possibly damaging Het
Cyp51 T A 5: 4,100,199 I175F probably damaging Het
Dennd4c C T 4: 86,805,591 P695S possibly damaging Het
Dlgap2 A T 8: 14,846,641 Q1039L probably damaging Het
Dnah14 T C 1: 181,666,361 L1694P probably benign Het
Dnah2 G A 11: 69,520,903 Q298* probably null Het
Dsg2 G T 18: 20,598,669 probably null Het
Esr2 A C 12: 76,121,869 V522G probably damaging Het
Fmo9 T A 1: 166,667,393 H262L probably benign Het
Glb1l T A 1: 75,201,407 M373L probably benign Het
Gls A G 1: 52,215,576 S247P probably benign Het
Gm37240 T A 3: 84,515,785 E213D probably damaging Het
Gmip T A 8: 69,817,372 V675E probably benign Het
Grb10 C A 11: 11,943,932 E330* probably null Het
Hist1h2ai A T 13: 21,716,689 N90Y probably damaging Het
Hivep2 A G 10: 14,129,992 K778R probably damaging Het
Ighv1-26 T C 12: 114,788,796 S4G probably benign Het
Igkv3-3 T A 6: 70,687,273 V33E possibly damaging Het
Itga2 C A 13: 114,866,190 G588V probably damaging Het
Itpr1 C T 6: 108,388,284 H58Y probably damaging Het
Jmjd1c T A 10: 67,248,048 D2365E possibly damaging Het
Limk1 T C 5: 134,657,955 Y518C probably damaging Het
March6 G C 15: 31,465,351 H802Q probably benign Het
Mark2 A G 19: 7,290,761 S26P probably benign Het
Mdn1 T A 4: 32,716,040 L2074Q probably damaging Het
Mrpl37 T C 4: 107,064,596 E174G possibly damaging Het
Mtcl1 T C 17: 66,379,331 H860R probably benign Het
Neurod1 A G 2: 79,454,161 F293L probably benign Het
Nwd1 C T 8: 72,662,186 R81W probably damaging Het
Nwd2 C A 5: 63,805,788 A905E probably benign Het
Olfr1375 T A 11: 51,048,768 Y220* probably null Het
Olfr1445 A C 19: 12,884,108 T76P probably damaging Het
Olfr307 A T 7: 86,336,384 I4N possibly damaging Het
Olfr860 A G 9: 19,845,728 I297T probably benign Het
Otop1 C A 5: 38,287,890 probably null Het
Otp A G 13: 94,875,780 H4R probably damaging Het
P4htm A C 9: 108,581,951 Y261D probably damaging Het
Pcsk5 A T 19: 17,473,041 C1148S probably damaging Het
Plekhg1 A T 10: 3,964,369 R1419W probably damaging Het
Prkd3 C A 17: 78,966,355 D491Y possibly damaging Het
Prr11 A C 11: 87,103,628 L64R possibly damaging Het
Pygo1 G T 9: 72,944,698 A56S probably damaging Het
Rexo5 A G 7: 119,805,247 T189A probably damaging Het
Rnf213 A T 11: 119,458,428 H3784L possibly damaging Het
Rps6ka5 T G 12: 100,595,920 probably null Het
Slco2b1 T A 7: 99,688,899 I93F probably damaging Het
Slfn8 T C 11: 83,003,864 *408W probably null Het
Sptbn1 C A 11: 30,159,443 E51* probably null Het
Ssc5d T A 7: 4,927,254 H111Q probably damaging Het
Sult1c1 T C 17: 53,973,953 N41D probably benign Het
Taar8c G A 10: 24,101,218 T232I probably benign Het
Tdo2 T C 3: 81,975,403 E2G possibly damaging Het
Tff2 T C 17: 31,144,178 E24G probably benign Het
Tjp2 C A 19: 24,125,704 probably null Het
Tnfrsf1b A T 4: 145,219,907 D311E probably benign Het
Usp15 G T 10: 123,168,305 N181K probably damaging Het
Vmn1r175 T G 7: 23,809,166 E12A possibly damaging Het
Vmn1r47 T C 6: 90,022,791 S302P probably damaging Het
Vmn2r58 A G 7: 41,837,401 M690T probably benign Het
Wee1 T A 7: 110,135,651 H465Q probably damaging Het
Zfr C T 15: 12,146,245 A294V unknown Het
Other mutations in Cenpe
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00655:Cenpe APN 3 135231455 critical splice donor site probably null
IGL00799:Cenpe APN 3 135228917 critical splice donor site probably null
IGL00815:Cenpe APN 3 135259351 missense probably benign
IGL01446:Cenpe APN 3 135237539 missense probably benign 0.01
IGL01469:Cenpe APN 3 135228806 missense probably damaging 1.00
IGL01843:Cenpe APN 3 135218507 missense possibly damaging 0.88
IGL02254:Cenpe APN 3 135255477 missense probably benign
IGL02337:Cenpe APN 3 135220276 splice site probably benign
IGL02382:Cenpe APN 3 135247386 missense probably benign
IGL02458:Cenpe APN 3 135230108 nonsense probably null
IGL02934:Cenpe APN 3 135264351 missense probably damaging 1.00
IGL03335:Cenpe APN 3 135243625 missense probably benign
R0086:Cenpe UTSW 3 135264424 splice site probably benign
R0173:Cenpe UTSW 3 135259983 missense probably benign 0.00
R0394:Cenpe UTSW 3 135216425 splice site probably benign
R0411:Cenpe UTSW 3 135222255 missense probably damaging 1.00
R0624:Cenpe UTSW 3 135246586 missense probably benign 0.00
R0634:Cenpe UTSW 3 135246827 missense probably damaging 1.00
R0648:Cenpe UTSW 3 135230082 missense probably damaging 1.00
R0691:Cenpe UTSW 3 135217305 missense probably damaging 1.00
R1184:Cenpe UTSW 3 135264422 critical splice donor site probably null
R1530:Cenpe UTSW 3 135246902 missense possibly damaging 0.92
R1559:Cenpe UTSW 3 135270900 missense probably benign 0.07
R1562:Cenpe UTSW 3 135238394 missense possibly damaging 0.53
R1568:Cenpe UTSW 3 135239758 missense probably benign 0.01
R1712:Cenpe UTSW 3 135265933 missense probably damaging 0.99
R1828:Cenpe UTSW 3 135246496 missense probably damaging 0.99
R1846:Cenpe UTSW 3 135239845 missense probably damaging 1.00
R1861:Cenpe UTSW 3 135268979 missense probably damaging 1.00
R1938:Cenpe UTSW 3 135247479 missense probably damaging 0.98
R1961:Cenpe UTSW 3 135242493 missense probably damaging 1.00
R2062:Cenpe UTSW 3 135222321 splice site probably benign
R2118:Cenpe UTSW 3 135246884 missense possibly damaging 0.94
R2127:Cenpe UTSW 3 135239780 missense probably benign 0.08
R2156:Cenpe UTSW 3 135247474 missense probably benign 0.34
R2265:Cenpe UTSW 3 135261636 missense probably benign 0.02
R2268:Cenpe UTSW 3 135261636 missense probably benign 0.02
R2392:Cenpe UTSW 3 135248113 missense probably damaging 1.00
R2508:Cenpe UTSW 3 135241073 missense possibly damaging 0.92
R3084:Cenpe UTSW 3 135241021 missense probably damaging 1.00
R3779:Cenpe UTSW 3 135256576 missense possibly damaging 0.87
R3833:Cenpe UTSW 3 135222322 splice site probably benign
R3974:Cenpe UTSW 3 135235225 splice site probably null
R3975:Cenpe UTSW 3 135235225 splice site probably null
R3975:Cenpe UTSW 3 135238472 critical splice donor site probably null
R4151:Cenpe UTSW 3 135215153 missense probably benign 0.36
R4166:Cenpe UTSW 3 135243718 missense probably damaging 1.00
R4581:Cenpe UTSW 3 135247000 missense probably benign 0.30
R4622:Cenpe UTSW 3 135243708 missense probably benign 0.22
R4692:Cenpe UTSW 3 135216379 missense probably benign 0.29
R4769:Cenpe UTSW 3 135248151 missense probably benign
R4976:Cenpe UTSW 3 135234876 missense probably damaging 1.00
R4983:Cenpe UTSW 3 135234928 missense probably damaging 1.00
R4990:Cenpe UTSW 3 135256640 missense probably damaging 1.00
R5002:Cenpe UTSW 3 135247081 missense probably benign
R5057:Cenpe UTSW 3 135220313 missense probably benign 0.14
R5063:Cenpe UTSW 3 135270954 missense probably damaging 0.99
R5181:Cenpe UTSW 3 135242303 missense probably damaging 0.99
R5281:Cenpe UTSW 3 135230150 missense possibly damaging 0.89
R5389:Cenpe UTSW 3 135259388 critical splice donor site probably null
R5517:Cenpe UTSW 3 135223265 missense probably damaging 1.00
R5521:Cenpe UTSW 3 135269065 missense probably damaging 1.00
R5607:Cenpe UTSW 3 135235076 nonsense probably null
R5608:Cenpe UTSW 3 135235076 nonsense probably null
R5627:Cenpe UTSW 3 135235473 missense possibly damaging 0.51
R5766:Cenpe UTSW 3 135248413 missense probably damaging 0.96
R5783:Cenpe UTSW 3 135261580 missense probably benign 0.00
R5933:Cenpe UTSW 3 135261628 missense probably benign 0.03
R6073:Cenpe UTSW 3 135260073 nonsense probably null
R6192:Cenpe UTSW 3 135248530 missense possibly damaging 0.93
R6224:Cenpe UTSW 3 135243775 missense possibly damaging 0.87
R6313:Cenpe UTSW 3 135230175 missense probably benign 0.26
R6326:Cenpe UTSW 3 135239778 missense probably benign 0.15
R6383:Cenpe UTSW 3 135251528 missense probably damaging 1.00
R6418:Cenpe UTSW 3 135251544 missense probably damaging 0.99
R6797:Cenpe UTSW 3 135238138 missense possibly damaging 0.92
R6810:Cenpe UTSW 3 135243822 missense probably benign 0.00
R6989:Cenpe UTSW 3 135235127 missense probably damaging 1.00
R7009:Cenpe UTSW 3 135235201 missense probably damaging 0.97
R7009:Cenpe UTSW 3 135235202 missense probably benign 0.02
R7039:Cenpe UTSW 3 135255456 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- AGCTAGTTAAGGTTATCTGCCTG -3'
(R):5'- ATCCGTCATGCAGTCAGAAC -3'

Sequencing Primer
(F):5'- CTGCAGGGGATCAGTACCAGATC -3'
(R):5'- CTGTCCATGAACTGAGAGATCTGC -3'
Posted On2017-10-10