Incidental Mutation 'R6163:Tnfrsf1b'
ID489956
Institutional Source Beutler Lab
Gene Symbol Tnfrsf1b
Ensembl Gene ENSMUSG00000028599
Gene Nametumor necrosis factor receptor superfamily, member 1b
SynonymsTNFalpha-R2, TNFBR, CD120b, TNFR80, TNF-R-II, TNF-R75, p75 TNFR, Tnfr2, p75, TNF-R2, TNFRII, TNF-alphaR2
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.344) question?
Stock #R6163 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location145213463-145246870 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 145219907 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 311 (D311E)
Ref Sequence ENSEMBL: ENSMUSP00000030336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030336]
Predicted Effect probably benign
Transcript: ENSMUST00000030336
AA Change: D311E

PolyPhen 2 Score 0.244 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000030336
Gene: ENSMUSG00000028599
AA Change: D311E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
TNFR 40 76 2.15e-9 SMART
TNFR 79 119 2.19e-10 SMART
TNFR 121 163 7.27e-7 SMART
TNFR 166 202 2.22e-2 SMART
transmembrane domain 263 285 N/A INTRINSIC
low complexity region 324 338 N/A INTRINSIC
low complexity region 363 378 N/A INTRINSIC
low complexity region 390 405 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF-receptor superfamily. This protein and TNF-receptor 1 form a heterocomplex that mediates the recruitment of two anti-apoptotic proteins, c-IAP1 and c-IAP2, which possess E3 ubiquitin ligase activity. The function of IAPs in TNF-receptor signalling is unknown, however, c-IAP1 is thought to potentiate TNF-induced apoptosis by the ubiquitination and degradation of TNF-receptor-associated factor 2, which mediates anti-apoptotic signals. Knockout studies in mice also suggest a role of this protein in protecting neurons from apoptosis by stimulating antioxidative pathways. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit altered inflammatory responses in a variety of experimental conditions, impaired recovery from spinal cord injury, enhanced ischemia-reperfusion-induced retinal damage, and resistance to cerebral malaria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik C T 5: 145,045,288 Q228* probably null Het
4922502D21Rik C T 6: 129,326,747 R85H probably benign Het
Asic5 A G 3: 82,006,526 N169S probably damaging Het
Atad2b T A 12: 4,954,593 L374H probably benign Het
BC080695 A G 4: 143,572,035 K183E probably damaging Het
Birc2 G A 9: 7,819,035 T544I probably benign Het
Blm GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCCTCCTCC 7: 80,512,904 probably benign Het
Cc2d2b C T 19: 40,756,506 T23I probably benign Het
Ccdc137 G T 11: 120,460,101 R108L possibly damaging Het
Cenpe T C 3: 135,269,003 I2308T probably damaging Het
Cpt1b T C 15: 89,424,417 T103A probably benign Het
Cpvl C A 6: 53,873,518 V445F probably damaging Het
Cttnbp2 A G 6: 18,434,951 S303P possibly damaging Het
Cyp17a1 T A 19: 46,669,322 I264F possibly damaging Het
Cyp51 T A 5: 4,100,199 I175F probably damaging Het
Dennd4c C T 4: 86,805,591 P695S possibly damaging Het
Dlgap2 A T 8: 14,846,641 Q1039L probably damaging Het
Dnah14 T C 1: 181,666,361 L1694P probably benign Het
Dnah2 G A 11: 69,520,903 Q298* probably null Het
Dsg2 G T 18: 20,598,669 probably null Het
Esr2 A C 12: 76,121,869 V522G probably damaging Het
Fmo9 T A 1: 166,667,393 H262L probably benign Het
Glb1l T A 1: 75,201,407 M373L probably benign Het
Gls A G 1: 52,215,576 S247P probably benign Het
Gm37240 T A 3: 84,515,785 E213D probably damaging Het
Gmip T A 8: 69,817,372 V675E probably benign Het
Grb10 C A 11: 11,943,932 E330* probably null Het
Hist1h2ai A T 13: 21,716,689 N90Y probably damaging Het
Hivep2 A G 10: 14,129,992 K778R probably damaging Het
Ighv1-26 T C 12: 114,788,796 S4G probably benign Het
Igkv3-3 T A 6: 70,687,273 V33E possibly damaging Het
Itga2 C A 13: 114,866,190 G588V probably damaging Het
Itpr1 C T 6: 108,388,284 H58Y probably damaging Het
Jmjd1c T A 10: 67,248,048 D2365E possibly damaging Het
Limk1 T C 5: 134,657,955 Y518C probably damaging Het
March6 G C 15: 31,465,351 H802Q probably benign Het
Mark2 A G 19: 7,290,761 S26P probably benign Het
Mdn1 T A 4: 32,716,040 L2074Q probably damaging Het
Mrpl37 T C 4: 107,064,596 E174G possibly damaging Het
Mtcl1 T C 17: 66,379,331 H860R probably benign Het
Neurod1 A G 2: 79,454,161 F293L probably benign Het
Nwd1 C T 8: 72,662,186 R81W probably damaging Het
Nwd2 C A 5: 63,805,788 A905E probably benign Het
Olfr1375 T A 11: 51,048,768 Y220* probably null Het
Olfr1445 A C 19: 12,884,108 T76P probably damaging Het
Olfr307 A T 7: 86,336,384 I4N possibly damaging Het
Olfr860 A G 9: 19,845,728 I297T probably benign Het
Otop1 C A 5: 38,287,890 probably null Het
Otp A G 13: 94,875,780 H4R probably damaging Het
P4htm A C 9: 108,581,951 Y261D probably damaging Het
Pcsk5 A T 19: 17,473,041 C1148S probably damaging Het
Plekhg1 A T 10: 3,964,369 R1419W probably damaging Het
Prkd3 C A 17: 78,966,355 D491Y possibly damaging Het
Prr11 A C 11: 87,103,628 L64R possibly damaging Het
Pygo1 G T 9: 72,944,698 A56S probably damaging Het
Rexo5 A G 7: 119,805,247 T189A probably damaging Het
Rnf213 A T 11: 119,458,428 H3784L possibly damaging Het
Rps6ka5 T G 12: 100,595,920 probably null Het
Slco2b1 T A 7: 99,688,899 I93F probably damaging Het
Slfn8 T C 11: 83,003,864 *408W probably null Het
Sptbn1 C A 11: 30,159,443 E51* probably null Het
Ssc5d T A 7: 4,927,254 H111Q probably damaging Het
Sult1c1 T C 17: 53,973,953 N41D probably benign Het
Taar8c G A 10: 24,101,218 T232I probably benign Het
Tdo2 T C 3: 81,975,403 E2G possibly damaging Het
Tff2 T C 17: 31,144,178 E24G probably benign Het
Tjp2 C A 19: 24,125,704 probably null Het
Usp15 G T 10: 123,168,305 N181K probably damaging Het
Vmn1r175 T G 7: 23,809,166 E12A possibly damaging Het
Vmn1r47 T C 6: 90,022,791 S302P probably damaging Het
Vmn2r58 A G 7: 41,837,401 M690T probably benign Het
Wee1 T A 7: 110,135,651 H465Q probably damaging Het
Zfr C T 15: 12,146,245 A294V unknown Het
Other mutations in Tnfrsf1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01375:Tnfrsf1b APN 4 145225416 missense probably damaging 1.00
IGL01716:Tnfrsf1b APN 4 145215923 missense probably damaging 0.97
IGL01974:Tnfrsf1b APN 4 145215851 missense probably damaging 1.00
IGL02631:Tnfrsf1b APN 4 145224828 missense probably damaging 1.00
R0011:Tnfrsf1b UTSW 4 145222966 missense possibly damaging 0.77
R0135:Tnfrsf1b UTSW 4 145229046 missense probably benign 0.15
R0194:Tnfrsf1b UTSW 4 145224812 missense probably benign 0.04
R0761:Tnfrsf1b UTSW 4 145216100 missense possibly damaging 0.95
R1124:Tnfrsf1b UTSW 4 145224356 missense probably benign 0.23
R1696:Tnfrsf1b UTSW 4 145227474 missense probably benign
R3692:Tnfrsf1b UTSW 4 145227522 missense probably benign 0.01
R4248:Tnfrsf1b UTSW 4 145215965 missense probably benign 0.01
R4409:Tnfrsf1b UTSW 4 145224285 nonsense probably null
R4957:Tnfrsf1b UTSW 4 145246757 missense probably damaging 0.99
R4957:Tnfrsf1b UTSW 4 145246758 missense possibly damaging 0.90
R5180:Tnfrsf1b UTSW 4 145227497 missense probably damaging 1.00
R5425:Tnfrsf1b UTSW 4 145229108 critical splice acceptor site probably null
R7055:Tnfrsf1b UTSW 4 145224887 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAATCCTGGAGCTGGCAC -3'
(R):5'- GGTGACACATCTCCCTATGC -3'

Sequencing Primer
(F):5'- ACGGGCCTCCTGAAACC -3'
(R):5'- CCTTGTGAGGACTGAGATTGAAAACC -3'
Posted On2017-10-10