Incidental Mutation 'R6163:1700018F24Rik'
List |< first << previous [record 62 of 33389] next >> last >|
ID489960
Institutional Source Beutler Lab
Gene Symbol 1700018F24Rik
Ensembl Gene ENSMUSG00000029620
Gene NameRIKEN cDNA 1700018F24 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.043) question?
Stock #R6163 (G1)
Quality Score204.009
Status Not validated
Chromosome5
Chromosomal Location145042990-145045681 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 145045288 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 228 (Q228*)
Ref Sequence ENSEMBL: ENSMUSP00000031624 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031624] [ENSMUST00000151196]
Predicted Effect probably null
Transcript: ENSMUST00000031624
AA Change: Q228*
SMART Domains Protein: ENSMUSP00000031624
Gene: ENSMUSG00000029620
AA Change: Q228*

DomainStartEndE-ValueType
Pfam:RasGEF_N 62 153 2.9e-10 PFAM
low complexity region 166 186 N/A INTRINSIC
low complexity region 230 241 N/A INTRINSIC
low complexity region 260 286 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151196
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik C T 6: 129,326,747 R85H probably benign Het
Asic5 A G 3: 82,006,526 N169S probably damaging Het
Atad2b T A 12: 4,954,593 L374H probably benign Het
BC080695 A G 4: 143,572,035 K183E probably damaging Het
Birc2 G A 9: 7,819,035 T544I probably benign Het
Blm GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCCTCCTCC 7: 80,512,904 probably benign Het
Cc2d2b C T 19: 40,756,506 T23I probably benign Het
Ccdc137 G T 11: 120,460,101 R108L possibly damaging Het
Cenpe T C 3: 135,269,003 I2308T probably damaging Het
Cpt1b T C 15: 89,424,417 T103A probably benign Het
Cpvl C A 6: 53,873,518 V445F probably damaging Het
Cttnbp2 A G 6: 18,434,951 S303P possibly damaging Het
Cyp17a1 T A 19: 46,669,322 I264F possibly damaging Het
Cyp51 T A 5: 4,100,199 I175F probably damaging Het
Dennd4c C T 4: 86,805,591 P695S possibly damaging Het
Dlgap2 A T 8: 14,846,641 Q1039L probably damaging Het
Dnah14 T C 1: 181,666,361 L1694P probably benign Het
Dnah2 G A 11: 69,520,903 Q298* probably null Het
Dsg2 G T 18: 20,598,669 probably null Het
Esr2 A C 12: 76,121,869 V522G probably damaging Het
Fmo9 T A 1: 166,667,393 H262L probably benign Het
Glb1l T A 1: 75,201,407 M373L probably benign Het
Gls A G 1: 52,215,576 S247P probably benign Het
Gm37240 T A 3: 84,515,785 E213D probably damaging Het
Gmip T A 8: 69,817,372 V675E probably benign Het
Grb10 C A 11: 11,943,932 E330* probably null Het
Hist1h2ai A T 13: 21,716,689 N90Y probably damaging Het
Hivep2 A G 10: 14,129,992 K778R probably damaging Het
Ighv1-26 T C 12: 114,788,796 S4G probably benign Het
Igkv3-3 T A 6: 70,687,273 V33E possibly damaging Het
Itga2 C A 13: 114,866,190 G588V probably damaging Het
Itpr1 C T 6: 108,388,284 H58Y probably damaging Het
Jmjd1c T A 10: 67,248,048 D2365E possibly damaging Het
Limk1 T C 5: 134,657,955 Y518C probably damaging Het
March6 G C 15: 31,465,351 H802Q probably benign Het
Mark2 A G 19: 7,290,761 S26P probably benign Het
Mdn1 T A 4: 32,716,040 L2074Q probably damaging Het
Mrpl37 T C 4: 107,064,596 E174G possibly damaging Het
Mtcl1 T C 17: 66,379,331 H860R probably benign Het
Neurod1 A G 2: 79,454,161 F293L probably benign Het
Nwd1 C T 8: 72,662,186 R81W probably damaging Het
Nwd2 C A 5: 63,805,788 A905E probably benign Het
Olfr1375 T A 11: 51,048,768 Y220* probably null Het
Olfr1445 A C 19: 12,884,108 T76P probably damaging Het
Olfr307 A T 7: 86,336,384 I4N possibly damaging Het
Olfr860 A G 9: 19,845,728 I297T probably benign Het
Otop1 C A 5: 38,287,890 probably null Het
Otp A G 13: 94,875,780 H4R probably damaging Het
P4htm A C 9: 108,581,951 Y261D probably damaging Het
Pcsk5 A T 19: 17,473,041 C1148S probably damaging Het
Plekhg1 A T 10: 3,964,369 R1419W probably damaging Het
Prkd3 C A 17: 78,966,355 D491Y possibly damaging Het
Prr11 A C 11: 87,103,628 L64R possibly damaging Het
Pygo1 G T 9: 72,944,698 A56S probably damaging Het
Rexo5 A G 7: 119,805,247 T189A probably damaging Het
Rnf213 A T 11: 119,458,428 H3784L possibly damaging Het
Rps6ka5 T G 12: 100,595,920 probably null Het
Slco2b1 T A 7: 99,688,899 I93F probably damaging Het
Slfn8 T C 11: 83,003,864 *408W probably null Het
Sptbn1 C A 11: 30,159,443 E51* probably null Het
Ssc5d T A 7: 4,927,254 H111Q probably damaging Het
Sult1c1 T C 17: 53,973,953 N41D probably benign Het
Taar8c G A 10: 24,101,218 T232I probably benign Het
Tdo2 T C 3: 81,975,403 E2G possibly damaging Het
Tff2 T C 17: 31,144,178 E24G probably benign Het
Tjp2 C A 19: 24,125,704 probably null Het
Tnfrsf1b A T 4: 145,219,907 D311E probably benign Het
Usp15 G T 10: 123,168,305 N181K probably damaging Het
Vmn1r175 T G 7: 23,809,166 E12A possibly damaging Het
Vmn1r47 T C 6: 90,022,791 S302P probably damaging Het
Vmn2r58 A G 7: 41,837,401 M690T probably benign Het
Wee1 T A 7: 110,135,651 H465Q probably damaging Het
Zfr C T 15: 12,146,245 A294V unknown Het
Other mutations in 1700018F24Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01625:1700018F24Rik APN 5 145043147 missense possibly damaging 0.83
IGL01751:1700018F24Rik APN 5 145043171 splice site probably null
IGL02928:1700018F24Rik APN 5 145043517 missense probably damaging 1.00
IGL03324:1700018F24Rik APN 5 145045451 missense probably benign 0.01
R0359:1700018F24Rik UTSW 5 145045371 nonsense probably null
R0554:1700018F24Rik UTSW 5 145045371 nonsense probably null
R0724:1700018F24Rik UTSW 5 145044763 missense probably benign 0.10
R1774:1700018F24Rik UTSW 5 145045541 missense probably damaging 0.99
R2041:1700018F24Rik UTSW 5 145045401 missense probably damaging 0.99
R4625:1700018F24Rik UTSW 5 145044883 missense possibly damaging 0.95
R5043:1700018F24Rik UTSW 5 145044100 nonsense probably null
R5610:1700018F24Rik UTSW 5 145045346 missense possibly damaging 0.92
R5712:1700018F24Rik UTSW 5 145044753 missense probably benign 0.32
R6799:1700018F24Rik UTSW 5 145044814 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAATCCTCTGGCATGAGAAGG -3'
(R):5'- ATCTCCAGCCTCATCTGCAG -3'

Sequencing Primer
(F):5'- CAATGGCATCTTGGGGAAGCTC -3'
(R):5'- AGCCTCATCTGCAGCCTCG -3'
Posted On2017-10-10