Incidental Mutation 'R6163:Hivep2'
ID489983
Institutional Source Beutler Lab
Gene Symbol Hivep2
Ensembl Gene ENSMUSG00000015501
Gene Namehuman immunodeficiency virus type I enhancer binding protein 2
SynonymsShn-2, MIBP1, Schnurri-2, Gm20114
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.887) question?
Stock #R6163 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location13966075-14151374 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 14129992 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 778 (K778R)
Ref Sequence ENSEMBL: ENSMUSP00000140150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015645] [ENSMUST00000186989] [ENSMUST00000187083] [ENSMUST00000191138]
Predicted Effect probably damaging
Transcript: ENSMUST00000015645
AA Change: K778R

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000015645
Gene: ENSMUSG00000015501
AA Change: K778R

DomainStartEndE-ValueType
low complexity region 177 188 N/A INTRINSIC
ZnF_C2H2 189 211 1.82e-3 SMART
ZnF_C2H2 217 239 7.26e-3 SMART
low complexity region 887 909 N/A INTRINSIC
low complexity region 922 937 N/A INTRINSIC
low complexity region 939 956 N/A INTRINSIC
low complexity region 958 974 N/A INTRINSIC
low complexity region 1499 1521 N/A INTRINSIC
low complexity region 1548 1569 N/A INTRINSIC
ZnF_C2H2 1783 1805 2.24e-3 SMART
ZnF_C2H2 1811 1835 1.98e-4 SMART
low complexity region 1853 1862 N/A INTRINSIC
low complexity region 1883 1910 N/A INTRINSIC
low complexity region 1943 1956 N/A INTRINSIC
low complexity region 2013 2038 N/A INTRINSIC
low complexity region 2090 2103 N/A INTRINSIC
low complexity region 2233 2241 N/A INTRINSIC
low complexity region 2271 2289 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186989
SMART Domains Protein: ENSMUSP00000140180
Gene: ENSMUSG00000015501

DomainStartEndE-ValueType
low complexity region 177 188 N/A INTRINSIC
ZnF_C2H2 189 211 7.9e-6 SMART
ZnF_C2H2 217 239 3.1e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000187083
AA Change: K778R

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140290
Gene: ENSMUSG00000015501
AA Change: K778R

DomainStartEndE-ValueType
low complexity region 177 188 N/A INTRINSIC
ZnF_C2H2 189 211 1.82e-3 SMART
ZnF_C2H2 217 239 7.26e-3 SMART
low complexity region 887 909 N/A INTRINSIC
low complexity region 922 937 N/A INTRINSIC
low complexity region 939 956 N/A INTRINSIC
low complexity region 958 974 N/A INTRINSIC
low complexity region 1499 1521 N/A INTRINSIC
low complexity region 1548 1569 N/A INTRINSIC
ZnF_C2H2 1783 1805 2.24e-3 SMART
ZnF_C2H2 1811 1835 1.98e-4 SMART
low complexity region 1853 1862 N/A INTRINSIC
low complexity region 1883 1910 N/A INTRINSIC
low complexity region 1943 1956 N/A INTRINSIC
low complexity region 2013 2038 N/A INTRINSIC
low complexity region 2090 2103 N/A INTRINSIC
low complexity region 2233 2241 N/A INTRINSIC
low complexity region 2271 2289 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000191138
AA Change: K778R

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140150
Gene: ENSMUSG00000015501
AA Change: K778R

DomainStartEndE-ValueType
low complexity region 177 188 N/A INTRINSIC
ZnF_C2H2 189 211 1.82e-3 SMART
ZnF_C2H2 217 239 7.26e-3 SMART
low complexity region 887 909 N/A INTRINSIC
low complexity region 922 937 N/A INTRINSIC
low complexity region 939 956 N/A INTRINSIC
low complexity region 958 974 N/A INTRINSIC
low complexity region 1499 1521 N/A INTRINSIC
low complexity region 1548 1569 N/A INTRINSIC
ZnF_C2H2 1783 1805 2.24e-3 SMART
ZnF_C2H2 1811 1835 1.98e-4 SMART
low complexity region 1853 1862 N/A INTRINSIC
low complexity region 1883 1910 N/A INTRINSIC
low complexity region 1943 1956 N/A INTRINSIC
low complexity region 2013 2038 N/A INTRINSIC
low complexity region 2090 2103 N/A INTRINSIC
low complexity region 2233 2241 N/A INTRINSIC
low complexity region 2271 2289 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of closely related, large, zinc finger-containing transcription factors. The encoded protein regulates transcription by binding to regulatory regions of various cellular and viral genes that maybe involved in growth, development and metastasis. The protein contains the ZAS domain comprised of two widely separated regions of zinc finger motifs, a stretch of highly acidic amino acids and a serine/threonine-rich sequence. [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a knock-out allele display abnormal thymus anatomy, severely defective positive selection of CD4+ and CD8+ cells, and enhanced T-helper 2 cell differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik C T 5: 145,045,288 Q228* probably null Het
4922502D21Rik C T 6: 129,326,747 R85H probably benign Het
Asic5 A G 3: 82,006,526 N169S probably damaging Het
Atad2b T A 12: 4,954,593 L374H probably benign Het
BC080695 A G 4: 143,572,035 K183E probably damaging Het
Birc2 G A 9: 7,819,035 T544I probably benign Het
Blm GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCCTCCTCC 7: 80,512,904 probably benign Het
Cc2d2b C T 19: 40,756,506 T23I probably benign Het
Ccdc137 G T 11: 120,460,101 R108L possibly damaging Het
Cenpe T C 3: 135,269,003 I2308T probably damaging Het
Cpt1b T C 15: 89,424,417 T103A probably benign Het
Cpvl C A 6: 53,873,518 V445F probably damaging Het
Cttnbp2 A G 6: 18,434,951 S303P possibly damaging Het
Cyp17a1 T A 19: 46,669,322 I264F possibly damaging Het
Cyp51 T A 5: 4,100,199 I175F probably damaging Het
Dennd4c C T 4: 86,805,591 P695S possibly damaging Het
Dlgap2 A T 8: 14,846,641 Q1039L probably damaging Het
Dnah14 T C 1: 181,666,361 L1694P probably benign Het
Dnah2 G A 11: 69,520,903 Q298* probably null Het
Dsg2 G T 18: 20,598,669 probably null Het
Esr2 A C 12: 76,121,869 V522G probably damaging Het
Fmo9 T A 1: 166,667,393 H262L probably benign Het
Glb1l T A 1: 75,201,407 M373L probably benign Het
Gls A G 1: 52,215,576 S247P probably benign Het
Gm37240 T A 3: 84,515,785 E213D probably damaging Het
Gmip T A 8: 69,817,372 V675E probably benign Het
Grb10 C A 11: 11,943,932 E330* probably null Het
Hist1h2ai A T 13: 21,716,689 N90Y probably damaging Het
Ighv1-26 T C 12: 114,788,796 S4G probably benign Het
Igkv3-3 T A 6: 70,687,273 V33E possibly damaging Het
Itga2 C A 13: 114,866,190 G588V probably damaging Het
Itpr1 C T 6: 108,388,284 H58Y probably damaging Het
Jmjd1c T A 10: 67,248,048 D2365E possibly damaging Het
Limk1 T C 5: 134,657,955 Y518C probably damaging Het
March6 G C 15: 31,465,351 H802Q probably benign Het
Mark2 A G 19: 7,290,761 S26P probably benign Het
Mdn1 T A 4: 32,716,040 L2074Q probably damaging Het
Mrpl37 T C 4: 107,064,596 E174G possibly damaging Het
Mtcl1 T C 17: 66,379,331 H860R probably benign Het
Neurod1 A G 2: 79,454,161 F293L probably benign Het
Nwd1 C T 8: 72,662,186 R81W probably damaging Het
Nwd2 C A 5: 63,805,788 A905E probably benign Het
Olfr1375 T A 11: 51,048,768 Y220* probably null Het
Olfr1445 A C 19: 12,884,108 T76P probably damaging Het
Olfr307 A T 7: 86,336,384 I4N possibly damaging Het
Olfr860 A G 9: 19,845,728 I297T probably benign Het
Otop1 C A 5: 38,287,890 probably null Het
Otp A G 13: 94,875,780 H4R probably damaging Het
P4htm A C 9: 108,581,951 Y261D probably damaging Het
Pcsk5 A T 19: 17,473,041 C1148S probably damaging Het
Plekhg1 A T 10: 3,964,369 R1419W probably damaging Het
Prkd3 C A 17: 78,966,355 D491Y possibly damaging Het
Prr11 A C 11: 87,103,628 L64R possibly damaging Het
Pygo1 G T 9: 72,944,698 A56S probably damaging Het
Rexo5 A G 7: 119,805,247 T189A probably damaging Het
Rnf213 A T 11: 119,458,428 H3784L possibly damaging Het
Rps6ka5 T G 12: 100,595,920 probably null Het
Slco2b1 T A 7: 99,688,899 I93F probably damaging Het
Slfn8 T C 11: 83,003,864 *408W probably null Het
Sptbn1 C A 11: 30,159,443 E51* probably null Het
Ssc5d T A 7: 4,927,254 H111Q probably damaging Het
Sult1c1 T C 17: 53,973,953 N41D probably benign Het
Taar8c G A 10: 24,101,218 T232I probably benign Het
Tdo2 T C 3: 81,975,403 E2G possibly damaging Het
Tff2 T C 17: 31,144,178 E24G probably benign Het
Tjp2 C A 19: 24,125,704 probably null Het
Tnfrsf1b A T 4: 145,219,907 D311E probably benign Het
Usp15 G T 10: 123,168,305 N181K probably damaging Het
Vmn1r175 T G 7: 23,809,166 E12A possibly damaging Het
Vmn1r47 T C 6: 90,022,791 S302P probably damaging Het
Vmn2r58 A G 7: 41,837,401 M690T probably benign Het
Wee1 T A 7: 110,135,651 H465Q probably damaging Het
Zfr C T 15: 12,146,245 A294V unknown Het
Other mutations in Hivep2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Hivep2 APN 10 14142244 missense probably damaging 1.00
IGL00963:Hivep2 APN 10 14129347 missense probably damaging 1.00
IGL01066:Hivep2 APN 10 14149024 missense possibly damaging 0.92
IGL01395:Hivep2 APN 10 14132800 critical splice donor site probably null
IGL01474:Hivep2 APN 10 14143662 missense probably damaging 1.00
IGL01481:Hivep2 APN 10 14149237 missense probably benign
IGL01597:Hivep2 APN 10 14149374 nonsense probably null
IGL01719:Hivep2 APN 10 14130523 missense probably damaging 1.00
IGL01952:Hivep2 APN 10 14142331 missense possibly damaging 0.54
IGL02170:Hivep2 APN 10 14127804 missense possibly damaging 0.46
IGL02315:Hivep2 APN 10 14131239 missense probably benign 0.01
IGL02517:Hivep2 APN 10 14131182 missense probably benign 0.01
IGL02535:Hivep2 APN 10 14139497 missense probably damaging 1.00
IGL02539:Hivep2 APN 10 14131878 missense probably damaging 0.97
IGL02637:Hivep2 APN 10 14130708 missense possibly damaging 0.89
IGL02715:Hivep2 APN 10 14131387 missense probably benign 0.03
IGL02948:Hivep2 APN 10 14129013 missense probably benign 0.44
IGL03113:Hivep2 APN 10 14130651 missense probably damaging 1.00
IGL03161:Hivep2 APN 10 14143356 missense probably damaging 1.00
IGL03173:Hivep2 APN 10 14127982 missense possibly damaging 0.75
IGL03310:Hivep2 APN 10 14143667 missense probably damaging 1.00
R0005:Hivep2 UTSW 10 14128749 missense probably damaging 0.99
R0053:Hivep2 UTSW 10 14132121 missense probably damaging 1.00
R0053:Hivep2 UTSW 10 14132121 missense probably damaging 1.00
R0136:Hivep2 UTSW 10 14131878 missense probably benign 0.04
R0143:Hivep2 UTSW 10 14129355 missense probably damaging 1.00
R0172:Hivep2 UTSW 10 14139474 missense probably damaging 1.00
R0226:Hivep2 UTSW 10 14129712 missense probably benign 0.26
R0348:Hivep2 UTSW 10 14129958 missense possibly damaging 0.76
R0352:Hivep2 UTSW 10 14143295 missense possibly damaging 0.74
R0657:Hivep2 UTSW 10 14131878 missense probably benign 0.04
R1710:Hivep2 UTSW 10 14129505 nonsense probably null
R1959:Hivep2 UTSW 10 14132709 missense probably benign 0.02
R2017:Hivep2 UTSW 10 14130757 missense probably damaging 0.96
R2085:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R2085:Hivep2 UTSW 10 14139529 nonsense probably null
R2163:Hivep2 UTSW 10 14128226 nonsense probably null
R2206:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R2207:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R2228:Hivep2 UTSW 10 14128363 missense probably damaging 1.00
R2241:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R2242:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R2243:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R2246:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R2247:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R2273:Hivep2 UTSW 10 14132443 missense probably benign 0.02
R2357:Hivep2 UTSW 10 14143299 missense probably benign 0.01
R2517:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R2519:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R2858:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R2859:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R2916:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R2921:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3051:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3177:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3277:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3620:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3621:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3701:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3802:Hivep2 UTSW 10 14148961 missense possibly damaging 0.94
R3810:Hivep2 UTSW 10 14130357 missense probably benign
R3811:Hivep2 UTSW 10 14130357 missense probably benign
R3817:Hivep2 UTSW 10 14143941 missense possibly damaging 0.46
R3818:Hivep2 UTSW 10 14143941 missense possibly damaging 0.46
R3819:Hivep2 UTSW 10 14143941 missense possibly damaging 0.46
R3836:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3837:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3838:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3839:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3897:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3900:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3932:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3954:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3957:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R4001:Hivep2 UTSW 10 14127732 missense probably damaging 1.00
R4134:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R4180:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R4248:Hivep2 UTSW 10 14131555 missense probably damaging 1.00
R4416:Hivep2 UTSW 10 14129170 missense probably benign
R4436:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R4437:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R4474:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R4475:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R4476:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R4636:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R4637:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R4791:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R4792:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R4825:Hivep2 UTSW 10 14131319 missense possibly damaging 0.81
R4955:Hivep2 UTSW 10 14130958 missense probably benign 0.44
R5094:Hivep2 UTSW 10 14132149 missense probably benign
R5129:Hivep2 UTSW 10 14130864 missense probably damaging 1.00
R5163:Hivep2 UTSW 10 14139425 missense probably damaging 1.00
R5255:Hivep2 UTSW 10 14131267 unclassified probably null
R5330:Hivep2 UTSW 10 14131420 missense probably damaging 1.00
R5341:Hivep2 UTSW 10 14132592 missense possibly damaging 0.94
R5453:Hivep2 UTSW 10 14128228 missense possibly damaging 0.78
R5513:Hivep2 UTSW 10 14132673 nonsense probably null
R5535:Hivep2 UTSW 10 14131022 missense probably benign 0.00
R5613:Hivep2 UTSW 10 14139495 missense probably damaging 1.00
R5804:Hivep2 UTSW 10 14133775 missense probably benign 0.01
R6074:Hivep2 UTSW 10 14131741 missense probably benign 0.18
R6250:Hivep2 UTSW 10 14131759 missense probably benign 0.01
R6696:Hivep2 UTSW 10 14133759 missense probably benign 0.06
R6754:Hivep2 UTSW 10 14129638 missense probably benign 0.06
R6756:Hivep2 UTSW 10 14132559 missense probably damaging 1.00
R6799:Hivep2 UTSW 10 14129013 missense probably benign 0.28
R6862:Hivep2 UTSW 10 14130583 missense probably damaging 1.00
R6932:Hivep2 UTSW 10 14128501 missense probably damaging 1.00
R6943:Hivep2 UTSW 10 14128314 missense probably damaging 1.00
R7027:Hivep2 UTSW 10 14149577 missense probably damaging 0.99
R7027:Hivep2 UTSW 10 14149578 missense probably damaging 1.00
R7198:Hivep2 UTSW 10 14129966 missense probably benign
R7248:Hivep2 UTSW 10 14131165 missense possibly damaging 0.86
R7256:Hivep2 UTSW 10 14129101 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- CCATGATCTGTGGTGGCATG -3'
(R):5'- ACAGGGGCTTCCAAAACCTC -3'

Sequencing Primer
(F):5'- GCATGATGTCCTCAGAGTACGAC -3'
(R):5'- CACTGTCACATGTCTCAGCAGG -3'
Posted On2017-10-10