Incidental Mutation 'R6165:Syne1'
ID490098
Institutional Source Beutler Lab
Gene Symbol Syne1
Ensembl Gene ENSMUSG00000096054
Gene Namespectrin repeat containing, nuclear envelope 1
SynonymsA330049M09Rik, enaptin165, SYNE-1, nesprin-1, C130039F11Rik
MMRRC Submission 044311-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6165 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location5020917-5551482 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 5425678 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 138 (L138Q)
Ref Sequence ENSEMBL: ENSMUSP00000150262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041639] [ENSMUST00000214945] [ENSMUST00000215295]
Predicted Effect probably damaging
Transcript: ENSMUST00000041639
AA Change: L138Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000039440
Gene: ENSMUSG00000096054
AA Change: L138Q

DomainStartEndE-ValueType
CH 29 139 4.55e-14 SMART
low complexity region 145 167 N/A INTRINSIC
CH 187 285 9.67e-18 SMART
coiled coil region 425 452 N/A INTRINSIC
Blast:SPEC 493 599 2e-28 BLAST
Blast:SPEC 606 695 7e-40 BLAST
Blast:SPEC 701 815 1e-32 BLAST
Blast:SPEC 815 913 4e-41 BLAST
Blast:SPEC 920 1013 9e-53 BLAST
Blast:SPEC 1117 1219 2e-60 BLAST
coiled coil region 1267 1329 N/A INTRINSIC
low complexity region 1349 1368 N/A INTRINSIC
coiled coil region 1399 1427 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000214945
AA Change: L131Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000215295
AA Change: L138Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.274 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.1%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a spectrin repeat containing protein expressed in skeletal and smooth muscle, and peripheral blood lymphocytes, that localizes to the nuclear membrane. Mutations in this gene have been associated with autosomal recessive spinocerebellar ataxia 8, also referred to as autosomal recessive cerebellar ataxia type 1 or recessive ataxia of Beauce. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an allele lacking the KASH domain exhibit neonatal and postnatal lethality, progressive muscular dystrophy, and limb weakness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd35 A G 3: 96,683,307 E303G possibly damaging Het
C2cd5 T C 6: 143,050,228 T389A possibly damaging Het
Catsperb T A 12: 101,575,816 Y592N possibly damaging Het
Cnot9 T C 1: 74,528,793 V280A probably benign Het
Cyld A G 8: 88,746,933 I927V possibly damaging Het
Etfdh A T 3: 79,604,944 S490T probably benign Het
Fam214a A G 9: 75,025,672 T974A probably damaging Het
Fance C T 17: 28,326,094 R150C probably benign Het
Far1 A G 7: 113,554,218 K353E probably benign Het
Fbn1 T C 2: 125,332,363 I1858V probably damaging Het
Frem1 T C 4: 82,956,255 K1359E probably benign Het
Ghdc T G 11: 100,769,102 E273A possibly damaging Het
Gpt A G 15: 76,697,970 D209G probably benign Het
H2afy A T 13: 56,104,455 N108K probably damaging Het
Hspb7 T C 4: 141,422,551 F83L probably benign Het
Itga7 A G 10: 128,942,935 I306M probably benign Het
Itgb5 A G 16: 33,899,242 E261G probably benign Het
Kcnj14 G T 7: 45,820,000 A27E possibly damaging Het
Kif13b A G 14: 64,742,311 H470R probably damaging Het
Maats1 A G 16: 38,333,811 F124S possibly damaging Het
Morc3 T C 16: 93,841,383 F18L probably damaging Het
Mrgprb8 T A 7: 48,388,817 C79S possibly damaging Het
Mroh2b T A 15: 4,918,350 M549K probably benign Het
Msl1 T C 11: 98,804,847 V563A probably damaging Het
Nwd1 C T 8: 72,662,186 R81W probably damaging Het
Olfr1489 A T 19: 13,633,143 I11F possibly damaging Het
Olfr1489 C T 19: 13,633,588 A159V probably benign Het
Phf2 C A 13: 48,813,865 probably null Het
Pjvk T G 2: 76,650,218 probably null Het
Rgl2 A G 17: 33,931,765 T66A probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Rtkn G T 6: 83,145,963 E67D probably damaging Het
Serpinb9 T A 13: 33,008,824 F121L possibly damaging Het
Slc17a2 G A 13: 23,815,070 V149I probably benign Het
Sobp A G 10: 43,022,603 S329P probably damaging Het
Tfr2 T A 5: 137,580,257 V449D probably damaging Het
Tmem151b T C 17: 45,545,785 Y243C probably damaging Het
Trank1 T C 9: 111,391,872 V2559A probably benign Het
Trim35 T C 14: 66,309,205 Y474H probably damaging Het
Uso1 A T 5: 92,187,267 L495F probably damaging Het
Wdr24 A G 17: 25,826,421 I377V probably benign Het
Xpo5 T A 17: 46,235,957 V878D possibly damaging Het
Zfc3h1 A G 10: 115,420,669 I1515V probably benign Het
Zfp319 CA C 8: 95,328,105 probably null Het
Zfp384 T G 6: 125,024,933 probably null Het
Zfp704 G T 3: 9,443,886 P416T probably benign Het
Zfr C T 15: 12,146,245 A294V unknown Het
Other mutations in Syne1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00684:Syne1 APN 10 5342167 synonymous probably benign
IGL00725:Syne1 APN 10 5344922 missense possibly damaging 0.48
IGL00799:Syne1 APN 10 5347878 missense probably benign 0.00
IGL01087:Syne1 APN 10 5425708 missense probably damaging 1.00
IGL01123:Syne1 APN 10 5344921 nonsense probably null
IGL01147:Syne1 APN 10 5052691 nonsense probably null
IGL01150:Syne1 APN 10 5443154 missense probably damaging 1.00
IGL01154:Syne1 APN 10 5360848 missense probably damaging 1.00
IGL01727:Syne1 APN 10 5047842 missense probably damaging 0.99
IGL01761:Syne1 APN 10 5405456 missense probably damaging 1.00
IGL01793:Syne1 APN 10 5352191 missense possibly damaging 0.67
IGL01961:Syne1 APN 10 5043723 missense possibly damaging 0.94
IGL01975:Syne1 APN 10 5068908 intron probably benign
IGL02152:Syne1 APN 10 5424382 missense probably damaging 1.00
IGL02423:Syne1 APN 10 5368295 missense probably benign 0.00
IGL02457:Syne1 APN 10 5342167 missense probably damaging 1.00
IGL02543:Syne1 APN 10 5043618 missense probably damaging 0.97
IGL02836:Syne1 APN 10 5409875 splice site probably benign
IGL03141:Syne1 APN 10 5424261 missense probably damaging 1.00
FR4548:Syne1 UTSW 10 5032969 missense probably benign 0.09
IGL02799:Syne1 UTSW 10 5359059 missense probably damaging 1.00
R0004:Syne1 UTSW 10 5443132 splice site probably benign
R0110:Syne1 UTSW 10 5367600 missense probably damaging 1.00
R0165:Syne1 UTSW 10 5033096 missense probably benign 0.28
R0194:Syne1 UTSW 10 5424311 missense probably benign
R0311:Syne1 UTSW 10 5348943 missense possibly damaging 0.92
R0328:Syne1 UTSW 10 5348945 missense possibly damaging 0.62
R0379:Syne1 UTSW 10 5541989 missense probably damaging 1.00
R0387:Syne1 UTSW 10 5351029 missense probably benign
R0452:Syne1 UTSW 10 5405435 missense probably damaging 0.98
R0456:Syne1 UTSW 10 5342252 missense probably benign 0.04
R0457:Syne1 UTSW 10 5022041 missense probably damaging 1.00
R0469:Syne1 UTSW 10 5367600 missense probably damaging 1.00
R0510:Syne1 UTSW 10 5367600 missense probably damaging 1.00
R0533:Syne1 UTSW 10 5358438 missense probably benign 0.00
R0617:Syne1 UTSW 10 5350933 missense probably damaging 1.00
R0690:Syne1 UTSW 10 5033138 splice site probably benign
R0964:Syne1 UTSW 10 5043652 missense possibly damaging 0.95
R1133:Syne1 UTSW 10 5349044 missense possibly damaging 0.77
R1327:Syne1 UTSW 10 5048925 splice site probably benign
R1339:Syne1 UTSW 10 5367571 missense probably damaging 1.00
R1531:Syne1 UTSW 10 5347875 nonsense probably null
R1558:Syne1 UTSW 10 5349280 nonsense probably null
R1633:Syne1 UTSW 10 5349388 missense probably damaging 1.00
R1642:Syne1 UTSW 10 5348694 missense possibly damaging 0.94
R1658:Syne1 UTSW 10 5367616 missense probably benign 0.03
R1753:Syne1 UTSW 10 5367621 missense probably benign 0.28
R1759:Syne1 UTSW 10 5349369 missense probably damaging 1.00
R1792:Syne1 UTSW 10 5040975 missense probably damaging 1.00
R2076:Syne1 UTSW 10 5040897 missense probably damaging 0.99
R2079:Syne1 UTSW 10 5361502 missense probably benign 0.01
R2102:Syne1 UTSW 10 5056514 missense probably damaging 1.00
R2233:Syne1 UTSW 10 5041484 missense probably benign 0.01
R2305:Syne1 UTSW 10 5047573 missense probably damaging 0.97
R3435:Syne1 UTSW 10 5348565 missense probably damaging 1.00
R3749:Syne1 UTSW 10 5052267 splice site probably benign
R3876:Syne1 UTSW 10 5052345 missense possibly damaging 0.57
R3895:Syne1 UTSW 10 5405456 missense probably damaging 0.98
R3974:Syne1 UTSW 10 5043630 missense probably benign 0.06
R4042:Syne1 UTSW 10 5041584 missense probably benign 0.21
R4120:Syne1 UTSW 10 5409798 missense probably damaging 1.00
R4201:Syne1 UTSW 10 5347870 missense probably benign
R4364:Syne1 UTSW 10 5353987 missense probably damaging 0.96
R4498:Syne1 UTSW 10 5031768 missense probably benign 0.00
R4767:Syne1 UTSW 10 5344866 nonsense probably null
R4804:Syne1 UTSW 10 5349310 missense possibly damaging 0.95
R4917:Syne1 UTSW 10 5057909 missense probably damaging 1.00
R4930:Syne1 UTSW 10 5052777 missense probably damaging 0.99
R5081:Syne1 UTSW 10 5047767 missense probably benign 0.04
R5089:Syne1 UTSW 10 5405444 nonsense probably null
R5174:Syne1 UTSW 10 5041490 missense probably damaging 0.99
R5205:Syne1 UTSW 10 5052295 missense probably benign 0.05
R5303:Syne1 UTSW 10 5420464 missense probably benign 0.00
R5384:Syne1 UTSW 10 5041494 missense probably benign 0.00
R5385:Syne1 UTSW 10 5041494 missense probably benign 0.00
R5392:Syne1 UTSW 10 5348661 missense probably damaging 1.00
R5442:Syne1 UTSW 10 5343473 missense probably benign 0.09
R5750:Syne1 UTSW 10 5339209 missense probably benign 0.01
R5935:Syne1 UTSW 10 5360706 unclassified probably null
R6015:Syne1 UTSW 10 5346819 critical splice donor site probably null
R6023:Syne1 UTSW 10 5443223 missense probably benign 0.09
R6049:Syne1 UTSW 10 5347926 missense possibly damaging 0.79
R6084:Syne1 UTSW 10 5348994 missense probably damaging 1.00
R6145:Syne1 UTSW 10 5052750 missense probably damaging 1.00
R6164:Syne1 UTSW 10 5061429 missense probably damaging 1.00
R6198:Syne1 UTSW 10 5302269 missense probably damaging 0.99
R6217:Syne1 UTSW 10 5293761 missense probably benign 0.00
R6247:Syne1 UTSW 10 5349071 missense probably damaging 0.98
R6271:Syne1 UTSW 10 5234652 missense probably damaging 1.00
R6338:Syne1 UTSW 10 5255475 missense probably benign 0.00
R6344:Syne1 UTSW 10 5022212 missense probably benign 0.08
R6434:Syne1 UTSW 10 5318422 missense probably benign 0.01
R6476:Syne1 UTSW 10 5154531 missense possibly damaging 0.88
R6479:Syne1 UTSW 10 5231679 nonsense probably null
R6479:Syne1 UTSW 10 5456826 missense probably damaging 1.00
R6546:Syne1 UTSW 10 5218645 nonsense probably null
R6578:Syne1 UTSW 10 5405454 nonsense probably null
R6611:Syne1 UTSW 10 5045273 missense probably benign 0.01
R6615:Syne1 UTSW 10 5301340 missense probably damaging 0.98
R6632:Syne1 UTSW 10 5215667 critical splice donor site probably null
R6662:Syne1 UTSW 10 5128416 missense probably damaging 1.00
R6677:Syne1 UTSW 10 5040942 missense possibly damaging 0.82
R6764:Syne1 UTSW 10 5229011 nonsense probably null
R6765:Syne1 UTSW 10 5143285 intron probably null
R6778:Syne1 UTSW 10 5102406 missense probably damaging 0.97
R6851:Syne1 UTSW 10 5262703 nonsense probably null
R6878:Syne1 UTSW 10 5420388 missense possibly damaging 0.78
R6885:Syne1 UTSW 10 5231704 nonsense probably null
R6910:Syne1 UTSW 10 5048887 missense probably benign 0.01
R6916:Syne1 UTSW 10 5227912 missense probably benign 0.00
R6925:Syne1 UTSW 10 5126682 missense probably benign 0.00
R6943:Syne1 UTSW 10 5083940 missense probably benign
R6947:Syne1 UTSW 10 5175789 missense probably damaging 1.00
R6965:Syne1 UTSW 10 5229120 missense possibly damaging 0.66
R6968:Syne1 UTSW 10 5117041 missense probably benign 0.09
R7043:Syne1 UTSW 10 5072193 missense possibly damaging 0.77
R7059:Syne1 UTSW 10 5346859 missense probably damaging 1.00
R7067:Syne1 UTSW 10 5234586 missense probably damaging 1.00
R7087:Syne1 UTSW 10 5542024
R7099:Syne1 UTSW 10 5123744 missense not run
R7107:Syne1 UTSW 10 5132078 missense not run
R7120:Syne1 UTSW 10 5293971 missense not run
R7127:Syne1 UTSW 10 5243180 missense not run
R7128:Syne1 UTSW 10 5243180 missense not run
R7131:Syne1 UTSW 10 5228221 missense not run
R7132:Syne1 UTSW 10 5243180 missense not run
R7133:Syne1 UTSW 10 5231592 missense not run
R7135:Syne1 UTSW 10 5233409 missense not run
R7147:Syne1 UTSW 10 5249340 missense not run
X0017:Syne1 UTSW 10 5346917 missense probably damaging 1.00
X0025:Syne1 UTSW 10 5358973 nonsense probably null
X0063:Syne1 UTSW 10 5052354 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTTATAAGGGTAGAGGGGTCACAC -3'
(R):5'- TGCCAGAACATAGGCATGCC -3'

Sequencing Primer
(F):5'- TTTAACCAAAGGGCGTGG -3'
(R):5'- GAACATAGGCATGCCCAAATG -3'
Posted On2017-10-10