Incidental Mutation 'R6165:Zfc3h1'
ID 490100
Institutional Source Beutler Lab
Gene Symbol Zfc3h1
Ensembl Gene ENSMUSG00000034163
Gene Name zinc finger, C3H1-type containing
Synonyms Ccdc131, Psrc2
MMRRC Submission 044311-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.943) question?
Stock # R6165 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 115220864-115268677 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 115256574 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 1515 (I1515V)
Ref Sequence ENSEMBL: ENSMUSP00000044069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036044]
AlphaFold B2RT41
Predicted Effect probably benign
Transcript: ENSMUST00000036044
AA Change: I1515V

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000044069
Gene: ENSMUSG00000034163
AA Change: I1515V

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 29 90 N/A INTRINSIC
low complexity region 120 132 N/A INTRINSIC
low complexity region 143 214 N/A INTRINSIC
coiled coil region 361 393 N/A INTRINSIC
low complexity region 399 432 N/A INTRINSIC
coiled coil region 436 491 N/A INTRINSIC
low complexity region 543 556 N/A INTRINSIC
low complexity region 564 583 N/A INTRINSIC
low complexity region 595 619 N/A INTRINSIC
low complexity region 623 636 N/A INTRINSIC
low complexity region 716 729 N/A INTRINSIC
low complexity region 752 763 N/A INTRINSIC
coiled coil region 826 889 N/A INTRINSIC
coiled coil region 968 1000 N/A INTRINSIC
low complexity region 1001 1015 N/A INTRINSIC
Pfam:zf-C3H1 1187 1208 1.3e-11 PFAM
HAT 1384 1416 1.11e0 SMART
HAT 1418 1449 4.35e2 SMART
Blast:HAT 1495 1538 2e-9 BLAST
HAT 1653 1685 3.31e1 SMART
HAT 1762 1797 7.03e1 SMART
HAT 1922 1954 1.29e-1 SMART
low complexity region 1975 1992 N/A INTRINSIC
Meta Mutation Damage Score 0.0824 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.1%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd35 A G 3: 96,590,623 (GRCm39) E303G possibly damaging Het
Atosa A G 9: 74,932,954 (GRCm39) T974A probably damaging Het
C2cd5 T C 6: 142,995,954 (GRCm39) T389A possibly damaging Het
Catsperb T A 12: 101,542,075 (GRCm39) Y592N possibly damaging Het
Cfap91 A G 16: 38,154,173 (GRCm39) F124S possibly damaging Het
Cnot9 T C 1: 74,567,952 (GRCm39) V280A probably benign Het
Cyld A G 8: 89,473,561 (GRCm39) I927V possibly damaging Het
Etfdh A T 3: 79,512,251 (GRCm39) S490T probably benign Het
Fance C T 17: 28,545,068 (GRCm39) R150C probably benign Het
Far1 A G 7: 113,153,425 (GRCm39) K353E probably benign Het
Fbn1 T C 2: 125,174,283 (GRCm39) I1858V probably damaging Het
Frem1 T C 4: 82,874,492 (GRCm39) K1359E probably benign Het
Ghdc T G 11: 100,659,928 (GRCm39) E273A possibly damaging Het
Gpt A G 15: 76,582,170 (GRCm39) D209G probably benign Het
Hspb7 T C 4: 141,149,862 (GRCm39) F83L probably benign Het
Itga7 A G 10: 128,778,804 (GRCm39) I306M probably benign Het
Itgb5 A G 16: 33,719,612 (GRCm39) E261G probably benign Het
Kcnj14 G T 7: 45,469,424 (GRCm39) A27E possibly damaging Het
Kif13b A G 14: 64,979,760 (GRCm39) H470R probably damaging Het
Macroh2a1 A T 13: 56,252,268 (GRCm39) N108K probably damaging Het
Morc3 T C 16: 93,638,271 (GRCm39) F18L probably damaging Het
Mrgprb8 T A 7: 48,038,565 (GRCm39) C79S possibly damaging Het
Mroh2b T A 15: 4,947,832 (GRCm39) M549K probably benign Het
Msl1 T C 11: 98,695,673 (GRCm39) V563A probably damaging Het
Nwd1 C T 8: 73,388,814 (GRCm39) R81W probably damaging Het
Or5b124 A T 19: 13,610,507 (GRCm39) I11F possibly damaging Het
Or5b124 C T 19: 13,610,952 (GRCm39) A159V probably benign Het
Phf2 C A 13: 48,967,341 (GRCm39) probably null Het
Pjvk T G 2: 76,480,562 (GRCm39) probably null Het
Rgl2 A G 17: 34,150,739 (GRCm39) T66A probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,229,111 (GRCm39) probably benign Het
Rtkn G T 6: 83,122,944 (GRCm39) E67D probably damaging Het
Serpinb9 T A 13: 33,192,807 (GRCm39) F121L possibly damaging Het
Slc34a1 G A 13: 23,999,053 (GRCm39) V149I probably benign Het
Sobp A G 10: 42,898,599 (GRCm39) S329P probably damaging Het
Syne1 A T 10: 5,375,678 (GRCm39) L138Q probably damaging Het
Tfr2 T A 5: 137,578,519 (GRCm39) V449D probably damaging Het
Tmem151b T C 17: 45,856,711 (GRCm39) Y243C probably damaging Het
Trank1 T C 9: 111,220,940 (GRCm39) V2559A probably benign Het
Trim35 T C 14: 66,546,654 (GRCm39) Y474H probably damaging Het
Uso1 A T 5: 92,335,126 (GRCm39) L495F probably damaging Het
Wdr24 A G 17: 26,045,395 (GRCm39) I377V probably benign Het
Xpo5 T A 17: 46,546,883 (GRCm39) V878D possibly damaging Het
Zfp319 CA C 8: 96,054,733 (GRCm39) 489 probably null Het
Zfp384 T G 6: 125,001,896 (GRCm39) probably null Het
Zfp704 G T 3: 9,508,946 (GRCm39) P416T probably benign Het
Zfr C T 15: 12,146,331 (GRCm39) A294V unknown Het
Other mutations in Zfc3h1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00698:Zfc3h1 APN 10 115,255,737 (GRCm39) missense possibly damaging 0.92
IGL00793:Zfc3h1 APN 10 115,252,779 (GRCm39) missense probably benign 0.00
IGL01349:Zfc3h1 APN 10 115,259,353 (GRCm39) missense probably damaging 1.00
IGL01431:Zfc3h1 APN 10 115,259,128 (GRCm39) missense possibly damaging 0.49
IGL02273:Zfc3h1 APN 10 115,263,004 (GRCm39) missense probably benign
IGL02382:Zfc3h1 APN 10 115,252,781 (GRCm39) nonsense probably null
IGL02397:Zfc3h1 APN 10 115,243,890 (GRCm39) missense probably damaging 1.00
IGL02657:Zfc3h1 APN 10 115,247,859 (GRCm39) missense possibly damaging 0.48
IGL02826:Zfc3h1 APN 10 115,236,809 (GRCm39) missense probably benign 0.42
Gnatcatcher UTSW 10 115,236,647 (GRCm39) missense probably benign 0.39
hutton UTSW 10 115,251,153 (GRCm39) missense probably damaging 0.96
passerine UTSW 10 115,249,916 (GRCm39) missense possibly damaging 0.56
R0178_Zfc3h1_655 UTSW 10 115,242,630 (GRCm39) splice site probably benign
vireo UTSW 10 115,255,806 (GRCm39) missense probably benign 0.01
warbler UTSW 10 115,242,388 (GRCm39) missense probably damaging 1.00
PIT4260001:Zfc3h1 UTSW 10 115,226,794 (GRCm39) missense probably damaging 0.99
PIT4354001:Zfc3h1 UTSW 10 115,262,944 (GRCm39) nonsense probably null
R0062:Zfc3h1 UTSW 10 115,252,658 (GRCm39) missense probably benign 0.00
R0062:Zfc3h1 UTSW 10 115,252,658 (GRCm39) missense probably benign 0.00
R0067:Zfc3h1 UTSW 10 115,259,379 (GRCm39) missense possibly damaging 0.88
R0067:Zfc3h1 UTSW 10 115,259,379 (GRCm39) missense possibly damaging 0.88
R0104:Zfc3h1 UTSW 10 115,251,192 (GRCm39) missense possibly damaging 0.66
R0178:Zfc3h1 UTSW 10 115,242,630 (GRCm39) splice site probably benign
R0355:Zfc3h1 UTSW 10 115,245,018 (GRCm39) missense possibly damaging 0.80
R0619:Zfc3h1 UTSW 10 115,256,715 (GRCm39) missense possibly damaging 0.92
R0731:Zfc3h1 UTSW 10 115,246,537 (GRCm39) missense probably benign 0.00
R0828:Zfc3h1 UTSW 10 115,237,612 (GRCm39) missense possibly damaging 0.68
R0866:Zfc3h1 UTSW 10 115,263,621 (GRCm39) missense probably benign 0.00
R1196:Zfc3h1 UTSW 10 115,247,866 (GRCm39) missense probably damaging 0.99
R1455:Zfc3h1 UTSW 10 115,248,013 (GRCm39) missense probably benign 0.11
R1515:Zfc3h1 UTSW 10 115,252,647 (GRCm39) missense probably benign 0.29
R1617:Zfc3h1 UTSW 10 115,226,827 (GRCm39) missense probably benign 0.01
R1640:Zfc3h1 UTSW 10 115,242,806 (GRCm39) splice site probably null
R1959:Zfc3h1 UTSW 10 115,259,158 (GRCm39) missense probably benign 0.34
R2039:Zfc3h1 UTSW 10 115,242,388 (GRCm39) missense probably damaging 1.00
R3430:Zfc3h1 UTSW 10 115,246,428 (GRCm39) splice site probably benign
R3691:Zfc3h1 UTSW 10 115,256,595 (GRCm39) missense probably benign
R3909:Zfc3h1 UTSW 10 115,255,806 (GRCm39) missense probably benign 0.01
R4235:Zfc3h1 UTSW 10 115,254,704 (GRCm39) missense probably benign 0.32
R4684:Zfc3h1 UTSW 10 115,259,290 (GRCm39) missense probably benign 0.03
R4816:Zfc3h1 UTSW 10 115,251,599 (GRCm39) missense probably benign 0.16
R4881:Zfc3h1 UTSW 10 115,236,647 (GRCm39) missense probably benign 0.39
R4883:Zfc3h1 UTSW 10 115,246,547 (GRCm39) missense probably damaging 1.00
R5038:Zfc3h1 UTSW 10 115,240,116 (GRCm39) missense probably benign 0.16
R5068:Zfc3h1 UTSW 10 115,254,688 (GRCm39) nonsense probably null
R5069:Zfc3h1 UTSW 10 115,254,688 (GRCm39) nonsense probably null
R5070:Zfc3h1 UTSW 10 115,254,688 (GRCm39) nonsense probably null
R5155:Zfc3h1 UTSW 10 115,248,026 (GRCm39) missense possibly damaging 0.64
R5190:Zfc3h1 UTSW 10 115,254,597 (GRCm39) missense probably damaging 1.00
R5499:Zfc3h1 UTSW 10 115,246,598 (GRCm39) missense probably damaging 1.00
R5932:Zfc3h1 UTSW 10 115,236,815 (GRCm39) missense probably benign 0.44
R5935:Zfc3h1 UTSW 10 115,267,262 (GRCm39) intron probably benign
R6182:Zfc3h1 UTSW 10 115,226,764 (GRCm39) missense probably benign 0.00
R6262:Zfc3h1 UTSW 10 115,249,881 (GRCm39) missense probably damaging 1.00
R6382:Zfc3h1 UTSW 10 115,243,813 (GRCm39) missense probably benign 0.06
R6392:Zfc3h1 UTSW 10 115,237,653 (GRCm39) missense probably damaging 1.00
R6539:Zfc3h1 UTSW 10 115,247,907 (GRCm39) missense probably benign 0.26
R6723:Zfc3h1 UTSW 10 115,256,638 (GRCm39) missense probably benign 0.34
R7339:Zfc3h1 UTSW 10 115,239,205 (GRCm39) missense probably damaging 1.00
R7381:Zfc3h1 UTSW 10 115,260,535 (GRCm39) missense probably benign
R7404:Zfc3h1 UTSW 10 115,251,153 (GRCm39) missense probably damaging 0.96
R7667:Zfc3h1 UTSW 10 115,246,606 (GRCm39) nonsense probably null
R7748:Zfc3h1 UTSW 10 115,236,720 (GRCm39) missense probably benign 0.27
R7910:Zfc3h1 UTSW 10 115,256,588 (GRCm39) nonsense probably null
R7914:Zfc3h1 UTSW 10 115,239,062 (GRCm39) splice site probably null
R8023:Zfc3h1 UTSW 10 115,256,553 (GRCm39) missense probably damaging 1.00
R8169:Zfc3h1 UTSW 10 115,254,616 (GRCm39) missense probably damaging 0.98
R8358:Zfc3h1 UTSW 10 115,240,198 (GRCm39) missense probably benign 0.13
R8746:Zfc3h1 UTSW 10 115,243,885 (GRCm39) missense probably damaging 1.00
R8803:Zfc3h1 UTSW 10 115,247,800 (GRCm39) missense probably benign
R8905:Zfc3h1 UTSW 10 115,259,383 (GRCm39) missense probably benign 0.05
R9045:Zfc3h1 UTSW 10 115,263,319 (GRCm39) missense possibly damaging 0.49
R9164:Zfc3h1 UTSW 10 115,259,374 (GRCm39) missense probably benign 0.17
R9211:Zfc3h1 UTSW 10 115,248,328 (GRCm39) missense possibly damaging 0.83
R9216:Zfc3h1 UTSW 10 115,221,528 (GRCm39) missense unknown
R9305:Zfc3h1 UTSW 10 115,255,771 (GRCm39) missense probably benign 0.19
R9372:Zfc3h1 UTSW 10 115,221,223 (GRCm39) missense unknown
R9394:Zfc3h1 UTSW 10 115,254,600 (GRCm39) missense probably damaging 1.00
R9414:Zfc3h1 UTSW 10 115,249,916 (GRCm39) missense possibly damaging 0.56
R9538:Zfc3h1 UTSW 10 115,221,197 (GRCm39) missense unknown
R9623:Zfc3h1 UTSW 10 115,259,362 (GRCm39) missense possibly damaging 0.94
R9633:Zfc3h1 UTSW 10 115,247,852 (GRCm39) missense probably damaging 1.00
R9747:Zfc3h1 UTSW 10 115,244,821 (GRCm39) missense possibly damaging 0.58
Z1176:Zfc3h1 UTSW 10 115,243,907 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTGCATTAGTGTGTCCCAAC -3'
(R):5'- TCTTGAGCTGCTTGCCATGG -3'

Sequencing Primer
(F):5'- ACACTAATGTCAGCACTTGGG -3'
(R):5'- CCATGGCATTACAAACGGTTCTG -3'
Posted On 2017-10-10