Incidental Mutation 'R6166:Gm15446'
ID490137
Institutional Source Beutler Lab
Gene Symbol Gm15446
Ensembl Gene ENSMUSG00000090015
Gene Namepredicted gene 15446
Synonyms
MMRRC Submission 044312-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R6166 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location109923400-109943936 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 109942780 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 299 (Y299*)
Ref Sequence ENSEMBL: ENSMUSP00000108163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112544] [ENSMUST00000170826]
Predicted Effect probably null
Transcript: ENSMUST00000112544
AA Change: Y299*
SMART Domains Protein: ENSMUSP00000108163
Gene: ENSMUSG00000090015
AA Change: Y299*

DomainStartEndE-ValueType
KRAB 4 60 1.74e-14 SMART
ZnF_C2H2 103 125 1.1e-2 SMART
ZnF_C2H2 131 153 1.67e-2 SMART
ZnF_C2H2 159 181 4.87e-4 SMART
ZnF_C2H2 187 209 3.39e-3 SMART
ZnF_C2H2 215 237 1.76e-1 SMART
ZnF_C2H2 243 265 1.3e-4 SMART
ZnF_C2H2 271 293 1.1e-2 SMART
ZnF_C2H2 299 321 2.27e-4 SMART
ZnF_C2H2 327 349 6.99e-5 SMART
ZnF_C2H2 355 377 5.21e-4 SMART
ZnF_C2H2 383 405 9.73e-4 SMART
ZnF_C2H2 411 433 3.39e-3 SMART
ZnF_C2H2 439 461 1.58e-3 SMART
ZnF_C2H2 467 489 5.14e-3 SMART
ZnF_C2H2 495 517 2.61e-4 SMART
ZnF_C2H2 523 545 3.21e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146564
Predicted Effect probably benign
Transcript: ENSMUST00000170826
SMART Domains Protein: ENSMUSP00000127438
Gene: ENSMUSG00000090015

DomainStartEndE-ValueType
KRAB 3 59 1.74e-14 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.7%
Validation Efficiency 97% (57/59)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,186,560 H478R probably benign Het
Acot2 A T 12: 83,992,604 N296Y probably damaging Het
Ago2 T A 15: 73,124,240 I347L probably benign Het
Aldh1l2 C T 10: 83,493,424 probably null Het
Ap1ar A G 3: 127,812,528 probably null Het
Arap3 T C 18: 37,974,370 T1365A probably damaging Het
Arhgef17 A T 7: 100,876,492 H1966Q probably damaging Het
Arpp21 T C 9: 112,119,198 T668A probably benign Het
Atg13 G T 2: 91,676,391 Q479K probably damaging Het
BC049730 A T 7: 24,714,219 Q220L probably benign Het
Bmp8a T C 4: 123,324,678 T183A probably benign Het
Camta2 G C 11: 70,674,261 probably null Het
Ccdc40 T C 11: 119,232,001 S210P probably benign Het
Cnn2 A G 10: 79,988,727 E17G possibly damaging Het
Cnot6l T C 5: 96,079,940 D478G possibly damaging Het
Csf2rb A G 15: 78,344,566 Y369C probably damaging Het
Dll4 A G 2: 119,334,626 probably null Het
Efcab6 A G 15: 83,896,115 V1039A probably benign Het
Fam117a T C 11: 95,380,781 M393T possibly damaging Het
Fancd2 T A 6: 113,555,251 N508K possibly damaging Het
Fat1 T C 8: 44,952,485 S758P probably damaging Het
Fgf20 T C 8: 40,279,840 K186E probably damaging Het
Filip1 T C 9: 79,819,454 K628E probably damaging Het
Fsip2 G T 2: 82,980,727 K2463N probably benign Het
Gm16432 A G 1: 178,103,837 T441A unknown Het
Gm7363 A T 7: 3,983,785 noncoding transcript Het
Gpx5 A T 13: 21,289,265 F104I probably damaging Het
Grip1 A T 10: 120,072,718 I618F probably damaging Het
Hmcn2 G A 2: 31,369,262 G1038D probably damaging Het
Lgals9 C T 11: 78,971,358 A134T probably benign Het
Lrba G A 3: 86,354,307 probably null Het
Naprt T C 15: 75,891,477 Q439R possibly damaging Het
Ndufs6 G A 13: 73,317,941 probably benign Het
Nodal C A 10: 61,424,558 S329R probably damaging Het
Olfm3 T A 3: 115,122,425 N315K probably damaging Het
Olfr420 A G 1: 174,159,093 T107A probably benign Het
Olfr730 C T 14: 50,186,768 V150I probably benign Het
Olfr803 A T 10: 129,691,279 I254K probably damaging Het
Plg T A 17: 12,398,114 V373E probably damaging Het
Prdm2 A C 4: 143,134,736 S661R probably damaging Het
Psg21 A T 7: 18,656,739 probably benign Het
Rhobtb2 T C 14: 69,798,178 D148G probably damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Scaf11 A T 15: 96,424,662 N116K probably damaging Het
Sf3a3 T C 4: 124,723,384 probably benign Homo
Slc38a9 T G 13: 112,695,267 Y184D possibly damaging Het
Sowahc A G 10: 59,222,360 D106G probably benign Het
Srbd1 T C 17: 86,099,268 Y563C probably damaging Het
Src A G 2: 157,468,522 Y359C probably damaging Het
Tbc1d9b A G 11: 50,135,846 D47G probably damaging Het
Tctn3 T C 19: 40,597,479 K541E possibly damaging Het
Tgm7 A G 2: 121,099,058 V245A probably damaging Het
Thbs2 C T 17: 14,680,388 R519H probably damaging Het
Tm4sf19 T C 16: 32,407,863 S157P probably damaging Het
Trio C T 15: 27,818,071 S507N probably damaging Het
Trrap T A 5: 144,781,981 H152Q possibly damaging Het
Vmn2r56 A G 7: 12,694,020 L773P probably damaging Het
Vmn2r70 A G 7: 85,565,981 L115P probably benign Het
Wdr59 C T 8: 111,472,661 R631H probably damaging Het
Other mutations in Gm15446
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01584:Gm15446 APN 5 109940802 makesense probably null
R0278:Gm15446 UTSW 5 109943415 missense probably benign 0.14
R0606:Gm15446 UTSW 5 109943481 missense probably benign
R1608:Gm15446 UTSW 5 109942457 missense probably damaging 1.00
R1874:Gm15446 UTSW 5 109942553 missense probably damaging 0.99
R1892:Gm15446 UTSW 5 109943387 missense probably damaging 1.00
R2000:Gm15446 UTSW 5 109942811 missense possibly damaging 0.67
R2059:Gm15446 UTSW 5 109942496 missense probably damaging 1.00
R3083:Gm15446 UTSW 5 109943292 missense possibly damaging 0.48
R3883:Gm15446 UTSW 5 109940447 missense probably damaging 0.98
R4086:Gm15446 UTSW 5 109943255 missense probably benign 0.02
R4095:Gm15446 UTSW 5 109940724 intron probably null
R4459:Gm15446 UTSW 5 109943241 missense probably benign 0.03
R4721:Gm15446 UTSW 5 109943000 missense probably damaging 1.00
R4735:Gm15446 UTSW 5 109942952 missense probably damaging 1.00
R5229:Gm15446 UTSW 5 109943170 missense probably damaging 1.00
R5502:Gm15446 UTSW 5 109940498 nonsense probably null
R6116:Gm15446 UTSW 5 109943036 missense probably damaging 1.00
R6322:Gm15446 UTSW 5 109943517 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTTGCACGACACAGTCATCTCAA -3'
(R):5'- TGAGAGGCAAAGGATTTAGTACAT -3'

Sequencing Primer
(F):5'- CAGTGTAGTAAAGCCTTTGCAC -3'
(R):5'- GGCAAAGGATTTAGTACATTGCTTAC -3'
Posted On2017-10-10