Incidental Mutation 'R6166:Fgf20'
ID490144
Institutional Source Beutler Lab
Gene Symbol Fgf20
Ensembl Gene ENSMUSG00000031603
Gene Namefibroblast growth factor 20
Synonyms
MMRRC Submission 044312-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6166 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location40279166-40308331 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 40279840 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 186 (K186E)
Ref Sequence ENSEMBL: ENSMUSP00000034014 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034014] [ENSMUST00000118639]
Predicted Effect probably damaging
Transcript: ENSMUST00000034014
AA Change: K186E

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000034014
Gene: ENSMUSG00000031603
AA Change: K186E

DomainStartEndE-ValueType
low complexity region 35 53 N/A INTRINSIC
FGF 63 194 3.3e-78 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000118639
AA Change: K132E

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112756
Gene: ENSMUSG00000031603
AA Change: K132E

DomainStartEndE-ValueType
FGF 6 140 2.08e-47 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.7%
Validation Efficiency 97% (57/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fibroblast growth factor family. The fibroblast growth factors possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This gene product is a secreted neurotrophic factor but lacks a typical signal peptide. It is expressed in normal brain, particularly the cerebellum, and may regulate central nervous system development and function. Homodimerization of this protein was shown to regulate its receptor binding activity and concentration gradient in the extracellular matrix. Genetic variations of this gene have been associated with Parkinson disease susceptibility. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit imapired coclear lateral compartment differentiation and deafness without loss of vestibular function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,186,560 H478R probably benign Het
Acot2 A T 12: 83,992,604 N296Y probably damaging Het
Ago2 T A 15: 73,124,240 I347L probably benign Het
Aldh1l2 C T 10: 83,493,424 probably null Het
Ap1ar A G 3: 127,812,528 probably null Het
Arap3 T C 18: 37,974,370 T1365A probably damaging Het
Arhgef17 A T 7: 100,876,492 H1966Q probably damaging Het
Arpp21 T C 9: 112,119,198 T668A probably benign Het
Atg13 G T 2: 91,676,391 Q479K probably damaging Het
BC049730 A T 7: 24,714,219 Q220L probably benign Het
Bmp8a T C 4: 123,324,678 T183A probably benign Het
Camta2 G C 11: 70,674,261 probably null Het
Ccdc40 T C 11: 119,232,001 S210P probably benign Het
Cnn2 A G 10: 79,988,727 E17G possibly damaging Het
Cnot6l T C 5: 96,079,940 D478G possibly damaging Het
Csf2rb A G 15: 78,344,566 Y369C probably damaging Het
Dll4 A G 2: 119,334,626 probably null Het
Efcab6 A G 15: 83,896,115 V1039A probably benign Het
Fam117a T C 11: 95,380,781 M393T possibly damaging Het
Fancd2 T A 6: 113,555,251 N508K possibly damaging Het
Fat1 T C 8: 44,952,485 S758P probably damaging Het
Filip1 T C 9: 79,819,454 K628E probably damaging Het
Fsip2 G T 2: 82,980,727 K2463N probably benign Het
Gm15446 T A 5: 109,942,780 Y299* probably null Het
Gm16432 A G 1: 178,103,837 T441A unknown Het
Gm7363 A T 7: 3,983,785 noncoding transcript Het
Gpx5 A T 13: 21,289,265 F104I probably damaging Het
Grip1 A T 10: 120,072,718 I618F probably damaging Het
Hmcn2 G A 2: 31,369,262 G1038D probably damaging Het
Lgals9 C T 11: 78,971,358 A134T probably benign Het
Lrba G A 3: 86,354,307 probably null Het
Naprt T C 15: 75,891,477 Q439R possibly damaging Het
Ndufs6 G A 13: 73,317,941 probably benign Het
Nodal C A 10: 61,424,558 S329R probably damaging Het
Olfm3 T A 3: 115,122,425 N315K probably damaging Het
Olfr420 A G 1: 174,159,093 T107A probably benign Het
Olfr730 C T 14: 50,186,768 V150I probably benign Het
Olfr803 A T 10: 129,691,279 I254K probably damaging Het
Plg T A 17: 12,398,114 V373E probably damaging Het
Prdm2 A C 4: 143,134,736 S661R probably damaging Het
Psg21 A T 7: 18,656,739 probably benign Het
Rhobtb2 T C 14: 69,798,178 D148G probably damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Scaf11 A T 15: 96,424,662 N116K probably damaging Het
Sf3a3 T C 4: 124,723,384 probably benign Homo
Slc38a9 T G 13: 112,695,267 Y184D possibly damaging Het
Sowahc A G 10: 59,222,360 D106G probably benign Het
Srbd1 T C 17: 86,099,268 Y563C probably damaging Het
Src A G 2: 157,468,522 Y359C probably damaging Het
Tbc1d9b A G 11: 50,135,846 D47G probably damaging Het
Tctn3 T C 19: 40,597,479 K541E possibly damaging Het
Tgm7 A G 2: 121,099,058 V245A probably damaging Het
Thbs2 C T 17: 14,680,388 R519H probably damaging Het
Tm4sf19 T C 16: 32,407,863 S157P probably damaging Het
Trio C T 15: 27,818,071 S507N probably damaging Het
Trrap T A 5: 144,781,981 H152Q possibly damaging Het
Vmn2r56 A G 7: 12,694,020 L773P probably damaging Het
Vmn2r70 A G 7: 85,565,981 L115P probably benign Het
Wdr59 C T 8: 111,472,661 R631H probably damaging Het
Other mutations in Fgf20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02730:Fgf20 APN 8 40279787 missense probably damaging 0.99
IGL03365:Fgf20 APN 8 40279891 missense possibly damaging 0.95
mermaid UTSW 8 40281148 missense probably damaging 0.98
LCD18:Fgf20 UTSW 8 40292318 intron probably benign
R1893:Fgf20 UTSW 8 40279803 missense possibly damaging 0.49
R4067:Fgf20 UTSW 8 40279855 missense probably benign 0.00
R4613:Fgf20 UTSW 8 40286611 missense probably benign
R6280:Fgf20 UTSW 8 40281112 nonsense probably null
R6869:Fgf20 UTSW 8 40281148 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCAGTGAAAAGCAGACTCCC -3'
(R):5'- AGAGTTGAGGCTTTTGTAAGGAAC -3'

Sequencing Primer
(F):5'- GCAGACTCCCGTAATATCCTG -3'
(R):5'- GAATGCATCTTCAGGGAAC -3'
Posted On2017-10-10