Incidental Mutation 'R6166:Nodal'
ID490150
Institutional Source Beutler Lab
Gene Symbol Nodal
Ensembl Gene ENSMUSG00000037171
Gene Namenodal
SynonymsTg.413d
MMRRC Submission 044312-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6166 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location61417972-61425338 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 61424558 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 329 (S329R)
Ref Sequence ENSEMBL: ENSMUSP00000039653 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020288] [ENSMUST00000049339]
Predicted Effect probably benign
Transcript: ENSMUST00000020288
SMART Domains Protein: ENSMUSP00000020288
Gene: ENSMUSG00000020091

DomainStartEndE-ValueType
Pfam:eIF_4EBP 1 120 4.2e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000049339
AA Change: S329R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039653
Gene: ENSMUSG00000037171
AA Change: S329R

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 235 244 N/A INTRINSIC
TGFB 254 354 2.6e-58 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.7%
Validation Efficiency 97% (57/59)
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate the mature protein, which regulates early embryonic development. Homozygous knockout mice for this gene exhibit early embryonic lethality, while expression of a hypomorphic allele results in defects in anteroposterior and left-right patterning. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous null mutants fail to form a primitive streak, show placental defects and die at gastrulation. Hypomorphic mutants are defective in anterior-posterior, anterior-midline, and left-right body patterning, resulting in multiple organ defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,186,560 H478R probably benign Het
Acot2 A T 12: 83,992,604 N296Y probably damaging Het
Ago2 T A 15: 73,124,240 I347L probably benign Het
Aldh1l2 C T 10: 83,493,424 probably null Het
Ap1ar A G 3: 127,812,528 probably null Het
Arap3 T C 18: 37,974,370 T1365A probably damaging Het
Arhgef17 A T 7: 100,876,492 H1966Q probably damaging Het
Arpp21 T C 9: 112,119,198 T668A probably benign Het
Atg13 G T 2: 91,676,391 Q479K probably damaging Het
BC049730 A T 7: 24,714,219 Q220L probably benign Het
Bmp8a T C 4: 123,324,678 T183A probably benign Het
Camta2 G C 11: 70,674,261 probably null Het
Ccdc40 T C 11: 119,232,001 S210P probably benign Het
Cnn2 A G 10: 79,988,727 E17G possibly damaging Het
Cnot6l T C 5: 96,079,940 D478G possibly damaging Het
Csf2rb A G 15: 78,344,566 Y369C probably damaging Het
Dll4 A G 2: 119,334,626 probably null Het
Efcab6 A G 15: 83,896,115 V1039A probably benign Het
Fam117a T C 11: 95,380,781 M393T possibly damaging Het
Fancd2 T A 6: 113,555,251 N508K possibly damaging Het
Fat1 T C 8: 44,952,485 S758P probably damaging Het
Fgf20 T C 8: 40,279,840 K186E probably damaging Het
Filip1 T C 9: 79,819,454 K628E probably damaging Het
Fsip2 G T 2: 82,980,727 K2463N probably benign Het
Gm15446 T A 5: 109,942,780 Y299* probably null Het
Gm16432 A G 1: 178,103,837 T441A unknown Het
Gm7363 A T 7: 3,983,785 noncoding transcript Het
Gpx5 A T 13: 21,289,265 F104I probably damaging Het
Grip1 A T 10: 120,072,718 I618F probably damaging Het
Hmcn2 G A 2: 31,369,262 G1038D probably damaging Het
Lgals9 C T 11: 78,971,358 A134T probably benign Het
Lrba G A 3: 86,354,307 probably null Het
Naprt T C 15: 75,891,477 Q439R possibly damaging Het
Ndufs6 G A 13: 73,317,941 probably benign Het
Olfm3 T A 3: 115,122,425 N315K probably damaging Het
Olfr420 A G 1: 174,159,093 T107A probably benign Het
Olfr730 C T 14: 50,186,768 V150I probably benign Het
Olfr803 A T 10: 129,691,279 I254K probably damaging Het
Plg T A 17: 12,398,114 V373E probably damaging Het
Prdm2 A C 4: 143,134,736 S661R probably damaging Het
Psg21 A T 7: 18,656,739 probably benign Het
Rhobtb2 T C 14: 69,798,178 D148G probably damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Scaf11 A T 15: 96,424,662 N116K probably damaging Het
Sf3a3 T C 4: 124,723,384 probably benign Homo
Slc38a9 T G 13: 112,695,267 Y184D possibly damaging Het
Sowahc A G 10: 59,222,360 D106G probably benign Het
Srbd1 T C 17: 86,099,268 Y563C probably damaging Het
Src A G 2: 157,468,522 Y359C probably damaging Het
Tbc1d9b A G 11: 50,135,846 D47G probably damaging Het
Tctn3 T C 19: 40,597,479 K541E possibly damaging Het
Tgm7 A G 2: 121,099,058 V245A probably damaging Het
Thbs2 C T 17: 14,680,388 R519H probably damaging Het
Tm4sf19 T C 16: 32,407,863 S157P probably damaging Het
Trio C T 15: 27,818,071 S507N probably damaging Het
Trrap T A 5: 144,781,981 H152Q possibly damaging Het
Vmn2r56 A G 7: 12,694,020 L773P probably damaging Het
Vmn2r70 A G 7: 85,565,981 L115P probably benign Het
Wdr59 C T 8: 111,472,661 R631H probably damaging Het
Other mutations in Nodal
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01589:Nodal APN 10 61418397 missense probably benign 0.00
IGL02153:Nodal APN 10 61424545 missense probably damaging 1.00
R1540:Nodal UTSW 10 61422985 missense probably damaging 0.96
R1993:Nodal UTSW 10 61418334 missense probably benign 0.05
R2086:Nodal UTSW 10 61423298 missense possibly damaging 0.76
R2317:Nodal UTSW 10 61418433 missense possibly damaging 0.83
R3110:Nodal UTSW 10 61424497 missense possibly damaging 0.75
R3112:Nodal UTSW 10 61424497 missense possibly damaging 0.75
R3973:Nodal UTSW 10 61423054 missense probably benign
R5785:Nodal UTSW 10 61423677 missense probably damaging 1.00
R5967:Nodal UTSW 10 61423667 missense probably damaging 0.99
R6212:Nodal UTSW 10 61423521 missense possibly damaging 0.82
R6238:Nodal UTSW 10 61423479 missense probably damaging 0.96
X0026:Nodal UTSW 10 61424560 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTTCCATGGGCAGCATTC -3'
(R):5'- GCAGAACTCTTCTAACGTTTCTGC -3'

Sequencing Primer
(F):5'- CCATGGGCAGCATTCTATTTATG -3'
(R):5'- TGCTCCCTGGATAGACACAATGG -3'
Posted On2017-10-10