Incidental Mutation 'R6166:Grip1'
ID490151
Institutional Source Beutler Lab
Gene Symbol Grip1
Ensembl Gene ENSMUSG00000034813
Gene Nameglutamate receptor interacting protein 1
Synonymseb
MMRRC Submission 044312-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6166 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location119453830-120087261 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 120072718 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 618 (I618F)
Ref Sequence ENSEMBL: ENSMUSP00000122349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041962] [ENSMUST00000077871] [ENSMUST00000081260] [ENSMUST00000105261] [ENSMUST00000105262] [ENSMUST00000130387] [ENSMUST00000138410] [ENSMUST00000144825] [ENSMUST00000144959] [ENSMUST00000147356] [ENSMUST00000147454] [ENSMUST00000148954] [ENSMUST00000154238]
Predicted Effect probably damaging
Transcript: ENSMUST00000041962
AA Change: I967F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000042436
Gene: ENSMUSG00000034813
AA Change: I967F

DomainStartEndE-ValueType
PDZ 63 137 4.86e-13 SMART
PDZ 161 239 6.4e-22 SMART
PDZ 262 337 1.97e-13 SMART
low complexity region 354 367 N/A INTRINSIC
low complexity region 388 405 N/A INTRINSIC
low complexity region 413 424 N/A INTRINSIC
PDZ 429 509 6.36e-17 SMART
PDZ 530 606 1.11e-16 SMART
PDZ 629 703 1.73e-18 SMART
PDZ 947 1019 2.79e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000077871
AA Change: I940F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000077033
Gene: ENSMUSG00000034813
AA Change: I940F

DomainStartEndE-ValueType
PDZ 36 110 4.86e-13 SMART
PDZ 134 212 6.4e-22 SMART
PDZ 235 310 1.97e-13 SMART
low complexity region 327 340 N/A INTRINSIC
low complexity region 361 378 N/A INTRINSIC
low complexity region 386 397 N/A INTRINSIC
PDZ 402 482 6.36e-17 SMART
PDZ 503 579 1.11e-16 SMART
PDZ 602 676 1.73e-18 SMART
PDZ 920 992 2.79e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000081260
AA Change: I538F

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000080016
Gene: ENSMUSG00000034813
AA Change: I538F

DomainStartEndE-ValueType
low complexity region 49 60 N/A INTRINSIC
PDZ 65 145 3e-19 SMART
PDZ 166 242 5.2e-19 SMART
PDZ 265 339 8.4e-21 SMART
PDZ 518 590 1.4e-15 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000105261
AA Change: I538F

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000100896
Gene: ENSMUSG00000034813
AA Change: I538F

DomainStartEndE-ValueType
low complexity region 49 60 N/A INTRINSIC
PDZ 65 145 6.36e-17 SMART
PDZ 166 242 1.11e-16 SMART
PDZ 265 339 1.73e-18 SMART
PDZ 518 590 2.79e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105262
AA Change: I966F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000100897
Gene: ENSMUSG00000034813
AA Change: I966F

DomainStartEndE-ValueType
PDZ 62 136 4.86e-13 SMART
PDZ 160 238 6.4e-22 SMART
PDZ 261 336 1.97e-13 SMART
low complexity region 353 366 N/A INTRINSIC
low complexity region 387 404 N/A INTRINSIC
low complexity region 412 423 N/A INTRINSIC
PDZ 428 508 6.36e-17 SMART
PDZ 529 605 1.11e-16 SMART
PDZ 628 702 1.73e-18 SMART
PDZ 946 1018 2.79e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127787
Predicted Effect probably damaging
Transcript: ENSMUST00000130387
AA Change: I603F

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000123288
Gene: ENSMUSG00000034813
AA Change: I603F

DomainStartEndE-ValueType
low complexity region 49 60 N/A INTRINSIC
PDZ 65 145 6.36e-17 SMART
PDZ 166 242 1.11e-16 SMART
PDZ 265 339 1.73e-18 SMART
PDZ 583 655 2.79e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000138410
AA Change: I1033F

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000123234
Gene: ENSMUSG00000034813
AA Change: I1033F

DomainStartEndE-ValueType
PDZ 62 136 4.86e-13 SMART
PDZ 160 238 6.4e-22 SMART
PDZ 261 336 1.97e-13 SMART
low complexity region 393 421 N/A INTRINSIC
low complexity region 439 456 N/A INTRINSIC
low complexity region 464 475 N/A INTRINSIC
PDZ 480 560 6.36e-17 SMART
PDZ 581 657 1.11e-16 SMART
PDZ 680 754 1.73e-18 SMART
PDZ 1013 1085 2.79e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139352
Predicted Effect probably damaging
Transcript: ENSMUST00000144825
AA Change: I939F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000121670
Gene: ENSMUSG00000034813
AA Change: I939F

DomainStartEndE-ValueType
PDZ 35 109 4.86e-13 SMART
PDZ 133 211 6.4e-22 SMART
PDZ 234 309 1.97e-13 SMART
low complexity region 326 339 N/A INTRINSIC
low complexity region 360 377 N/A INTRINSIC
low complexity region 385 396 N/A INTRINSIC
PDZ 401 481 6.36e-17 SMART
PDZ 502 578 1.11e-16 SMART
PDZ 601 675 1.73e-18 SMART
PDZ 919 991 2.79e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000144959
AA Change: I1018F

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000122323
Gene: ENSMUSG00000034813
AA Change: I1018F

DomainStartEndE-ValueType
PDZ 62 136 4.86e-13 SMART
PDZ 160 238 6.4e-22 SMART
PDZ 261 336 1.97e-13 SMART
low complexity region 393 421 N/A INTRINSIC
low complexity region 439 456 N/A INTRINSIC
low complexity region 464 475 N/A INTRINSIC
PDZ 480 560 6.36e-17 SMART
PDZ 581 657 1.11e-16 SMART
PDZ 680 754 1.73e-18 SMART
PDZ 998 1070 2.79e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000147356
AA Change: I1019F

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000115478
Gene: ENSMUSG00000034813
AA Change: I1019F

DomainStartEndE-ValueType
PDZ 63 137 4.86e-13 SMART
PDZ 161 239 6.4e-22 SMART
PDZ 262 337 1.97e-13 SMART
low complexity region 394 422 N/A INTRINSIC
low complexity region 440 457 N/A INTRINSIC
low complexity region 465 476 N/A INTRINSIC
PDZ 481 561 6.36e-17 SMART
PDZ 582 658 1.11e-16 SMART
PDZ 681 755 1.73e-18 SMART
PDZ 999 1071 2.79e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000147454
AA Change: I1018F

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000118073
Gene: ENSMUSG00000034813
AA Change: I1018F

DomainStartEndE-ValueType
PDZ 62 136 4.86e-13 SMART
PDZ 160 238 6.4e-22 SMART
PDZ 261 336 1.97e-13 SMART
low complexity region 393 421 N/A INTRINSIC
low complexity region 439 456 N/A INTRINSIC
low complexity region 464 475 N/A INTRINSIC
PDZ 480 560 6.36e-17 SMART
PDZ 581 657 1.11e-16 SMART
PDZ 680 754 1.73e-18 SMART
PDZ 998 1070 2.79e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000148954
AA Change: I981F

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000118397
Gene: ENSMUSG00000034813
AA Change: I981F

DomainStartEndE-ValueType
PDZ 62 136 4.86e-13 SMART
PDZ 160 238 6.4e-22 SMART
PDZ 261 336 1.97e-13 SMART
low complexity region 353 366 N/A INTRINSIC
low complexity region 387 404 N/A INTRINSIC
low complexity region 412 423 N/A INTRINSIC
PDZ 428 508 6.36e-17 SMART
PDZ 529 605 1.11e-16 SMART
PDZ 628 702 1.73e-18 SMART
PDZ 961 1033 2.79e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000154238
AA Change: I618F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122349
Gene: ENSMUSG00000034813
AA Change: I618F

DomainStartEndE-ValueType
low complexity region 49 60 N/A INTRINSIC
PDZ 65 145 6.36e-17 SMART
PDZ 166 242 1.11e-16 SMART
PDZ 265 339 1.73e-18 SMART
PDZ 598 670 2.79e-13 SMART
Meta Mutation Damage Score 0.35 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.7%
Validation Efficiency 97% (57/59)
MGI Phenotype FUNCTION: This gene encodes a protein containing multiple PDZ (post synaptic density protein, Drosophila disc large tumor suppressor, and zonula occludens-1 protein) domains. The encoded protein acts as a mediator between cytoskeletal and membrane proteins, particularly in neuronal cells, and facilitates complex formation at the cell membrane. Mutation of this gene can cause embryonic lethality resulting from defects of the dermo-epidermal junction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygous ablation of gene function results in embryonic lethality and blistering skin lesions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,186,560 H478R probably benign Het
Acot2 A T 12: 83,992,604 N296Y probably damaging Het
Ago2 T A 15: 73,124,240 I347L probably benign Het
Aldh1l2 C T 10: 83,493,424 probably null Het
Ap1ar A G 3: 127,812,528 probably null Het
Arap3 T C 18: 37,974,370 T1365A probably damaging Het
Arhgef17 A T 7: 100,876,492 H1966Q probably damaging Het
Arpp21 T C 9: 112,119,198 T668A probably benign Het
Atg13 G T 2: 91,676,391 Q479K probably damaging Het
BC049730 A T 7: 24,714,219 Q220L probably benign Het
Bmp8a T C 4: 123,324,678 T183A probably benign Het
Camta2 G C 11: 70,674,261 probably null Het
Ccdc40 T C 11: 119,232,001 S210P probably benign Het
Cnn2 A G 10: 79,988,727 E17G possibly damaging Het
Cnot6l T C 5: 96,079,940 D478G possibly damaging Het
Csf2rb A G 15: 78,344,566 Y369C probably damaging Het
Dll4 A G 2: 119,334,626 probably null Het
Efcab6 A G 15: 83,896,115 V1039A probably benign Het
Fam117a T C 11: 95,380,781 M393T possibly damaging Het
Fancd2 T A 6: 113,555,251 N508K possibly damaging Het
Fat1 T C 8: 44,952,485 S758P probably damaging Het
Fgf20 T C 8: 40,279,840 K186E probably damaging Het
Filip1 T C 9: 79,819,454 K628E probably damaging Het
Fsip2 G T 2: 82,980,727 K2463N probably benign Het
Gm15446 T A 5: 109,942,780 Y299* probably null Het
Gm16432 A G 1: 178,103,837 T441A unknown Het
Gm7363 A T 7: 3,983,785 noncoding transcript Het
Gpx5 A T 13: 21,289,265 F104I probably damaging Het
Hmcn2 G A 2: 31,369,262 G1038D probably damaging Het
Lgals9 C T 11: 78,971,358 A134T probably benign Het
Lrba G A 3: 86,354,307 probably null Het
Naprt T C 15: 75,891,477 Q439R possibly damaging Het
Ndufs6 G A 13: 73,317,941 probably benign Het
Nodal C A 10: 61,424,558 S329R probably damaging Het
Olfm3 T A 3: 115,122,425 N315K probably damaging Het
Olfr420 A G 1: 174,159,093 T107A probably benign Het
Olfr730 C T 14: 50,186,768 V150I probably benign Het
Olfr803 A T 10: 129,691,279 I254K probably damaging Het
Plg T A 17: 12,398,114 V373E probably damaging Het
Prdm2 A C 4: 143,134,736 S661R probably damaging Het
Psg21 A T 7: 18,656,739 probably benign Het
Rhobtb2 T C 14: 69,798,178 D148G probably damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Scaf11 A T 15: 96,424,662 N116K probably damaging Het
Sf3a3 T C 4: 124,723,384 probably benign Homo
Slc38a9 T G 13: 112,695,267 Y184D possibly damaging Het
Sowahc A G 10: 59,222,360 D106G probably benign Het
Srbd1 T C 17: 86,099,268 Y563C probably damaging Het
Src A G 2: 157,468,522 Y359C probably damaging Het
Tbc1d9b A G 11: 50,135,846 D47G probably damaging Het
Tctn3 T C 19: 40,597,479 K541E possibly damaging Het
Tgm7 A G 2: 121,099,058 V245A probably damaging Het
Thbs2 C T 17: 14,680,388 R519H probably damaging Het
Tm4sf19 T C 16: 32,407,863 S157P probably damaging Het
Trio C T 15: 27,818,071 S507N probably damaging Het
Trrap T A 5: 144,781,981 H152Q possibly damaging Het
Vmn2r56 A G 7: 12,694,020 L773P probably damaging Het
Vmn2r70 A G 7: 85,565,981 L115P probably benign Het
Wdr59 C T 8: 111,472,661 R631H probably damaging Het
Other mutations in Grip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Grip1 APN 10 119931302 nonsense probably null
IGL01374:Grip1 APN 10 120049368 missense probably benign 0.03
IGL01592:Grip1 APN 10 119930003 missense probably damaging 1.00
IGL02207:Grip1 APN 10 120075309 missense probably damaging 1.00
IGL02222:Grip1 APN 10 119999809 missense probably damaging 1.00
IGL02225:Grip1 APN 10 120049453 missense probably damaging 1.00
IGL02447:Grip1 APN 10 120020071 missense probably damaging 1.00
IGL02492:Grip1 APN 10 119930040 splice site probably benign
IGL02522:Grip1 APN 10 119931249 missense probably damaging 1.00
IGL02574:Grip1 APN 10 119942913 missense probably damaging 1.00
IGL02718:Grip1 APN 10 120075515 makesense probably null
IGL02751:Grip1 APN 10 119978577 missense probably benign 0.08
IGL03221:Grip1 APN 10 119986394 missense probably benign 0.00
IGL03377:Grip1 APN 10 120055032 missense probably damaging 0.98
PIT4403001:Grip1 UTSW 10 119929928 missense probably damaging 1.00
R0304:Grip1 UTSW 10 120075471 missense probably benign 0.31
R0681:Grip1 UTSW 10 120010230 missense probably damaging 1.00
R0760:Grip1 UTSW 10 120018078 missense probably damaging 0.96
R1457:Grip1 UTSW 10 119986350 missense possibly damaging 0.73
R1506:Grip1 UTSW 10 119978451 missense probably damaging 1.00
R1541:Grip1 UTSW 10 120000543 missense probably damaging 0.99
R1553:Grip1 UTSW 10 120054851 missense probably damaging 1.00
R1709:Grip1 UTSW 10 119897715 missense probably damaging 0.98
R2055:Grip1 UTSW 10 120049511 splice site probably benign
R2059:Grip1 UTSW 10 120038698 missense possibly damaging 0.80
R2261:Grip1 UTSW 10 119985584 missense probably benign 0.00
R2475:Grip1 UTSW 10 119978496 missense probably benign 0.01
R3777:Grip1 UTSW 10 119985630 critical splice donor site probably null
R3849:Grip1 UTSW 10 119929958 missense probably damaging 1.00
R3956:Grip1 UTSW 10 119930026 missense probably damaging 1.00
R4643:Grip1 UTSW 10 120020101 missense probably damaging 1.00
R4693:Grip1 UTSW 10 120000554 missense probably benign 0.10
R4724:Grip1 UTSW 10 120038683 missense probably benign 0.02
R4843:Grip1 UTSW 10 119930015 missense probably damaging 1.00
R4884:Grip1 UTSW 10 120075306 missense probably damaging 1.00
R4912:Grip1 UTSW 10 119931248 missense probably damaging 1.00
R5185:Grip1 UTSW 10 119931259 missense probably benign 0.37
R5291:Grip1 UTSW 10 120086969 missense probably benign 0.04
R5293:Grip1 UTSW 10 119897735 missense probably damaging 0.99
R5296:Grip1 UTSW 10 119929928 missense probably damaging 1.00
R5302:Grip1 UTSW 10 120020077 missense probably damaging 1.00
R5541:Grip1 UTSW 10 120072718 missense probably damaging 1.00
R5792:Grip1 UTSW 10 119985480 missense probably benign 0.07
R5861:Grip1 UTSW 10 119929970 missense probably damaging 1.00
R5905:Grip1 UTSW 10 119985492 missense probably benign 0.02
R5949:Grip1 UTSW 10 120050242 missense probably benign 0.00
R6112:Grip1 UTSW 10 119993232 missense probably benign 0.00
R6167:Grip1 UTSW 10 119897797 critical splice donor site probably null
R6193:Grip1 UTSW 10 120038314 missense probably damaging 1.00
R6218:Grip1 UTSW 10 119986346 missense possibly damaging 0.95
R6267:Grip1 UTSW 10 120075464 nonsense probably null
R6296:Grip1 UTSW 10 120075464 nonsense probably null
R6490:Grip1 UTSW 10 119986424 missense possibly damaging 0.82
R6543:Grip1 UTSW 10 119985594 missense probably benign 0.00
R6558:Grip1 UTSW 10 119454383 missense probably benign 0.00
R6995:Grip1 UTSW 10 119986470 missense probably damaging 0.99
R7122:Grip1 UTSW 10 120035374 missense possibly damaging 0.48
R7157:Grip1 UTSW 10 119945156 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACATCGCCAAGTCCACTATG -3'
(R):5'- TTCACCGCCAGTAGTTCCATAG -3'

Sequencing Primer
(F):5'- GCTATGAAATTAGTTTGTGACGCTCC -3'
(R):5'- ACCGCCAGTAGTTCCATAGTTTGAG -3'
Posted On2017-10-10