Incidental Mutation 'R6166:Tbc1d9b'
ID490153
Institutional Source Beutler Lab
Gene Symbol Tbc1d9b
Ensembl Gene ENSMUSG00000036644
Gene NameTBC1 domain family, member 9B
Synonyms2700008N14Rik
MMRRC Submission 044312-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.764) question?
Stock #R6166 (G1)
Quality Score194.009
Status Validated
Chromosome11
Chromosomal Location50131396-50172785 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 50135846 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 47 (D47G)
Ref Sequence ENSEMBL: ENSMUSP00000098828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093138] [ENSMUST00000101270]
Predicted Effect probably damaging
Transcript: ENSMUST00000093138
AA Change: D47G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090825
Gene: ENSMUSG00000036644
AA Change: D47G

DomainStartEndE-ValueType
low complexity region 35 51 N/A INTRINSIC
GRAM 142 209 1.21e-26 SMART
GRAM 288 356 3.02e-22 SMART
low complexity region 357 368 N/A INTRINSIC
low complexity region 422 447 N/A INTRINSIC
low complexity region 470 481 N/A INTRINSIC
TBC 506 719 1.18e-57 SMART
Blast:TBC 727 810 2e-28 BLAST
low complexity region 1124 1138 N/A INTRINSIC
low complexity region 1144 1155 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000101270
AA Change: D47G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098828
Gene: ENSMUSG00000036644
AA Change: D47G

DomainStartEndE-ValueType
low complexity region 35 51 N/A INTRINSIC
GRAM 142 209 1.21e-26 SMART
GRAM 288 356 3.02e-22 SMART
low complexity region 357 368 N/A INTRINSIC
low complexity region 422 447 N/A INTRINSIC
low complexity region 470 481 N/A INTRINSIC
TBC 506 719 1.18e-57 SMART
Blast:TBC 727 810 3e-28 BLAST
low complexity region 970 980 N/A INTRINSIC
low complexity region 1141 1155 N/A INTRINSIC
low complexity region 1161 1172 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126758
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144990
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147628
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.7%
Validation Efficiency 97% (57/59)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,186,560 H478R probably benign Het
Acot2 A T 12: 83,992,604 N296Y probably damaging Het
Ago2 T A 15: 73,124,240 I347L probably benign Het
Aldh1l2 C T 10: 83,493,424 probably null Het
Ap1ar A G 3: 127,812,528 probably null Het
Arap3 T C 18: 37,974,370 T1365A probably damaging Het
Arhgef17 A T 7: 100,876,492 H1966Q probably damaging Het
Arpp21 T C 9: 112,119,198 T668A probably benign Het
Atg13 G T 2: 91,676,391 Q479K probably damaging Het
BC049730 A T 7: 24,714,219 Q220L probably benign Het
Bmp8a T C 4: 123,324,678 T183A probably benign Het
Camta2 G C 11: 70,674,261 probably null Het
Ccdc40 T C 11: 119,232,001 S210P probably benign Het
Cnn2 A G 10: 79,988,727 E17G possibly damaging Het
Cnot6l T C 5: 96,079,940 D478G possibly damaging Het
Csf2rb A G 15: 78,344,566 Y369C probably damaging Het
Dll4 A G 2: 119,334,626 probably null Het
Efcab6 A G 15: 83,896,115 V1039A probably benign Het
Fam117a T C 11: 95,380,781 M393T possibly damaging Het
Fancd2 T A 6: 113,555,251 N508K possibly damaging Het
Fat1 T C 8: 44,952,485 S758P probably damaging Het
Fgf20 T C 8: 40,279,840 K186E probably damaging Het
Filip1 T C 9: 79,819,454 K628E probably damaging Het
Fsip2 G T 2: 82,980,727 K2463N probably benign Het
Gm15446 T A 5: 109,942,780 Y299* probably null Het
Gm16432 A G 1: 178,103,837 T441A unknown Het
Gm7363 A T 7: 3,983,785 noncoding transcript Het
Gpx5 A T 13: 21,289,265 F104I probably damaging Het
Grip1 A T 10: 120,072,718 I618F probably damaging Het
Hmcn2 G A 2: 31,369,262 G1038D probably damaging Het
Lgals9 C T 11: 78,971,358 A134T probably benign Het
Lrba G A 3: 86,354,307 probably null Het
Naprt T C 15: 75,891,477 Q439R possibly damaging Het
Ndufs6 G A 13: 73,317,941 probably benign Het
Nodal C A 10: 61,424,558 S329R probably damaging Het
Olfm3 T A 3: 115,122,425 N315K probably damaging Het
Olfr420 A G 1: 174,159,093 T107A probably benign Het
Olfr730 C T 14: 50,186,768 V150I probably benign Het
Olfr803 A T 10: 129,691,279 I254K probably damaging Het
Plg T A 17: 12,398,114 V373E probably damaging Het
Prdm2 A C 4: 143,134,736 S661R probably damaging Het
Psg21 A T 7: 18,656,739 probably benign Het
Rhobtb2 T C 14: 69,798,178 D148G probably damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Scaf11 A T 15: 96,424,662 N116K probably damaging Het
Sf3a3 T C 4: 124,723,384 probably benign Homo
Slc38a9 T G 13: 112,695,267 Y184D possibly damaging Het
Sowahc A G 10: 59,222,360 D106G probably benign Het
Srbd1 T C 17: 86,099,268 Y563C probably damaging Het
Src A G 2: 157,468,522 Y359C probably damaging Het
Tctn3 T C 19: 40,597,479 K541E possibly damaging Het
Tgm7 A G 2: 121,099,058 V245A probably damaging Het
Thbs2 C T 17: 14,680,388 R519H probably damaging Het
Tm4sf19 T C 16: 32,407,863 S157P probably damaging Het
Trio C T 15: 27,818,071 S507N probably damaging Het
Trrap T A 5: 144,781,981 H152Q possibly damaging Het
Vmn2r56 A G 7: 12,694,020 L773P probably damaging Het
Vmn2r70 A G 7: 85,565,981 L115P probably benign Het
Wdr59 C T 8: 111,472,661 R631H probably damaging Het
Other mutations in Tbc1d9b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01868:Tbc1d9b APN 11 50161633 missense probably damaging 1.00
IGL01870:Tbc1d9b APN 11 50162088 missense probably damaging 1.00
IGL02082:Tbc1d9b APN 11 50163882 missense probably benign 0.00
IGL02105:Tbc1d9b APN 11 50149826 missense probably damaging 0.96
IGL02264:Tbc1d9b APN 11 50149757 missense probably damaging 0.98
IGL02801:Tbc1d9b APN 11 50152830 missense probably damaging 1.00
IGL03111:Tbc1d9b APN 11 50158542 missense probably damaging 1.00
IGL02988:Tbc1d9b UTSW 11 50151946 missense possibly damaging 0.80
R0102:Tbc1d9b UTSW 11 50135849 missense probably damaging 1.00
R0109:Tbc1d9b UTSW 11 50158434 missense probably benign 0.02
R0131:Tbc1d9b UTSW 11 50135924 missense probably benign
R0463:Tbc1d9b UTSW 11 50145067 missense probably benign 0.00
R0472:Tbc1d9b UTSW 11 50168228 splice site probably null
R0846:Tbc1d9b UTSW 11 50171321 missense probably benign 0.01
R1099:Tbc1d9b UTSW 11 50146308 missense probably benign 0.04
R1276:Tbc1d9b UTSW 11 50152649 missense possibly damaging 0.87
R1642:Tbc1d9b UTSW 11 50149832 missense probably damaging 0.98
R2679:Tbc1d9b UTSW 11 50161701 splice site probably null
R2915:Tbc1d9b UTSW 11 50149736 missense possibly damaging 0.95
R3825:Tbc1d9b UTSW 11 50171127 missense possibly damaging 0.85
R3964:Tbc1d9b UTSW 11 50168696 missense possibly damaging 0.50
R4051:Tbc1d9b UTSW 11 50171243 missense probably benign 0.09
R4705:Tbc1d9b UTSW 11 50140462 missense probably benign 0.33
R4783:Tbc1d9b UTSW 11 50171298 missense probably benign 0.00
R5330:Tbc1d9b UTSW 11 50146313 missense probably benign
R5331:Tbc1d9b UTSW 11 50146313 missense probably benign
R5888:Tbc1d9b UTSW 11 50140484 missense probably benign 0.15
R5949:Tbc1d9b UTSW 11 50148049 missense probably benign
R6144:Tbc1d9b UTSW 11 50146328 missense probably benign
R6331:Tbc1d9b UTSW 11 50131497 missense possibly damaging 0.95
R6432:Tbc1d9b UTSW 11 50146328 missense probably benign
R6856:Tbc1d9b UTSW 11 50168746 missense probably benign 0.11
R7110:Tbc1d9b UTSW 11 50163830 missense probably benign 0.09
R7134:Tbc1d9b UTSW 11 50152692 missense possibly damaging 0.55
X0065:Tbc1d9b UTSW 11 50168183 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTTTGAGAGACTGGCTGGAAGC -3'
(R):5'- GTCCAACCACATCTCCCTTGAG -3'

Sequencing Primer
(F):5'- AAGCCTGTGAGTAGTTGGAAGTC -3'
(R):5'- CCCAGGAGCTTCTTATCATGG -3'
Posted On2017-10-10