Incidental Mutation 'R6166:Rhobtb2'
ID490162
Institutional Source Beutler Lab
Gene Symbol Rhobtb2
Ensembl Gene ENSMUSG00000022075
Gene NameRho-related BTB domain containing 2
SynonymsDbc2, E130206H14Rik
MMRRC Submission 044312-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6166 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location69784990-69805636 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 69798178 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 148 (D148G)
Ref Sequence ENSEMBL: ENSMUSP00000022665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022665]
Predicted Effect probably damaging
Transcript: ENSMUST00000022665
AA Change: D148G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022665
Gene: ENSMUSG00000022075
AA Change: D148G

DomainStartEndE-ValueType
RHO 17 210 4.86e-36 SMART
low complexity region 227 249 N/A INTRINSIC
BTB 266 472 5.27e-15 SMART
BTB 500 598 2.78e-14 SMART
low complexity region 706 726 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223603
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224535
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225088
Meta Mutation Damage Score 0.206 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.7%
Validation Efficiency 97% (57/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a small Rho GTPase and a candidate tumor suppressor. The encoded protein interacts with the cullin-3 protein, a ubiquitin E3 ligase necessary for mitotic cell division. This protein inhibits the growth and spread of some types of breast cancer. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,186,560 H478R probably benign Het
Acot2 A T 12: 83,992,604 N296Y probably damaging Het
Ago2 T A 15: 73,124,240 I347L probably benign Het
Aldh1l2 C T 10: 83,493,424 probably null Het
Ap1ar A G 3: 127,812,528 probably null Het
Arap3 T C 18: 37,974,370 T1365A probably damaging Het
Arhgef17 A T 7: 100,876,492 H1966Q probably damaging Het
Arpp21 T C 9: 112,119,198 T668A probably benign Het
Atg13 G T 2: 91,676,391 Q479K probably damaging Het
BC049730 A T 7: 24,714,219 Q220L probably benign Het
Bmp8a T C 4: 123,324,678 T183A probably benign Het
Camta2 G C 11: 70,674,261 probably null Het
Ccdc40 T C 11: 119,232,001 S210P probably benign Het
Cnn2 A G 10: 79,988,727 E17G possibly damaging Het
Cnot6l T C 5: 96,079,940 D478G possibly damaging Het
Csf2rb A G 15: 78,344,566 Y369C probably damaging Het
Dll4 A G 2: 119,334,626 probably null Het
Efcab6 A G 15: 83,896,115 V1039A probably benign Het
Fam117a T C 11: 95,380,781 M393T possibly damaging Het
Fancd2 T A 6: 113,555,251 N508K possibly damaging Het
Fat1 T C 8: 44,952,485 S758P probably damaging Het
Fgf20 T C 8: 40,279,840 K186E probably damaging Het
Filip1 T C 9: 79,819,454 K628E probably damaging Het
Fsip2 G T 2: 82,980,727 K2463N probably benign Het
Gm15446 T A 5: 109,942,780 Y299* probably null Het
Gm16432 A G 1: 178,103,837 T441A unknown Het
Gm7363 A T 7: 3,983,785 noncoding transcript Het
Gpx5 A T 13: 21,289,265 F104I probably damaging Het
Grip1 A T 10: 120,072,718 I618F probably damaging Het
Hmcn2 G A 2: 31,369,262 G1038D probably damaging Het
Lgals9 C T 11: 78,971,358 A134T probably benign Het
Lrba G A 3: 86,354,307 probably null Het
Naprt T C 15: 75,891,477 Q439R possibly damaging Het
Ndufs6 G A 13: 73,317,941 probably benign Het
Nodal C A 10: 61,424,558 S329R probably damaging Het
Olfm3 T A 3: 115,122,425 N315K probably damaging Het
Olfr420 A G 1: 174,159,093 T107A probably benign Het
Olfr730 C T 14: 50,186,768 V150I probably benign Het
Olfr803 A T 10: 129,691,279 I254K probably damaging Het
Plg T A 17: 12,398,114 V373E probably damaging Het
Prdm2 A C 4: 143,134,736 S661R probably damaging Het
Psg21 A T 7: 18,656,739 probably benign Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Scaf11 A T 15: 96,424,662 N116K probably damaging Het
Sf3a3 T C 4: 124,723,384 probably benign Homo
Slc38a9 T G 13: 112,695,267 Y184D possibly damaging Het
Sowahc A G 10: 59,222,360 D106G probably benign Het
Srbd1 T C 17: 86,099,268 Y563C probably damaging Het
Src A G 2: 157,468,522 Y359C probably damaging Het
Tbc1d9b A G 11: 50,135,846 D47G probably damaging Het
Tctn3 T C 19: 40,597,479 K541E possibly damaging Het
Tgm7 A G 2: 121,099,058 V245A probably damaging Het
Thbs2 C T 17: 14,680,388 R519H probably damaging Het
Tm4sf19 T C 16: 32,407,863 S157P probably damaging Het
Trio C T 15: 27,818,071 S507N probably damaging Het
Trrap T A 5: 144,781,981 H152Q possibly damaging Het
Vmn2r56 A G 7: 12,694,020 L773P probably damaging Het
Vmn2r70 A G 7: 85,565,981 L115P probably benign Het
Wdr59 C T 8: 111,472,661 R631H probably damaging Het
Other mutations in Rhobtb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01482:Rhobtb2 APN 14 69796588 missense possibly damaging 0.82
IGL02437:Rhobtb2 APN 14 69795916 missense probably damaging 1.00
Paunchy UTSW 14 69798178 missense probably damaging 1.00
reeses UTSW 14 69799711 missense probably damaging 1.00
smoke UTSW 14 69796444 missense probably damaging 0.99
waft UTSW 14 69796735 missense probably benign 0.22
R0034:Rhobtb2 UTSW 14 69788688 missense probably benign
R0149:Rhobtb2 UTSW 14 69795908 missense probably benign 0.02
R0361:Rhobtb2 UTSW 14 69795908 missense probably benign 0.02
R0376:Rhobtb2 UTSW 14 69796735 missense probably benign 0.22
R0594:Rhobtb2 UTSW 14 69793948 missense probably benign
R1005:Rhobtb2 UTSW 14 69798277 missense probably damaging 1.00
R1072:Rhobtb2 UTSW 14 69787527 small deletion probably benign
R1929:Rhobtb2 UTSW 14 69796444 missense probably damaging 0.99
R1938:Rhobtb2 UTSW 14 69796613 missense probably benign 0.01
R2058:Rhobtb2 UTSW 14 69794039 missense possibly damaging 0.49
R2244:Rhobtb2 UTSW 14 69787527 small deletion probably benign
R2992:Rhobtb2 UTSW 14 69798323 missense probably damaging 1.00
R3953:Rhobtb2 UTSW 14 69794039 missense possibly damaging 0.49
R4655:Rhobtb2 UTSW 14 69795989 missense probably damaging 0.97
R4712:Rhobtb2 UTSW 14 69799711 missense probably damaging 1.00
R4744:Rhobtb2 UTSW 14 69794002 missense probably damaging 1.00
R4771:Rhobtb2 UTSW 14 69797050 missense probably benign 0.20
R5648:Rhobtb2 UTSW 14 69797144 missense probably damaging 1.00
R5990:Rhobtb2 UTSW 14 69796369 missense probably damaging 1.00
R6186:Rhobtb2 UTSW 14 69798244 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAATACAGAACAAGACCGTC -3'
(R):5'- GAGCTTTCTGTGCCGCTAAC -3'

Sequencing Primer
(F):5'- GTGAATGAATGAATGAGCATGTTTG -3'
(R):5'- AGCTTTCTGTGCCGCTAACTTTTC -3'
Posted On2017-10-10