Incidental Mutation 'R0528:Tnrc6b'
ID49017
Institutional Source Beutler Lab
Gene Symbol Tnrc6b
Ensembl Gene ENSMUSG00000047888
Gene Nametrinucleotide repeat containing 6b
Synonyms
MMRRC Submission 038720-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.323) question?
Stock #R0528 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location80711313-80941085 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80879403 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 369 (S369P)
Ref Sequence ENSEMBL: ENSMUSP00000064336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067689]
Predicted Effect probably benign
Transcript: ENSMUST00000067689
AA Change: S369P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000064336
Gene: ENSMUSG00000047888
AA Change: S369P

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
coiled coil region 33 72 N/A INTRINSIC
low complexity region 88 106 N/A INTRINSIC
low complexity region 155 174 N/A INTRINSIC
low complexity region 207 220 N/A INTRINSIC
low complexity region 242 260 N/A INTRINSIC
low complexity region 331 346 N/A INTRINSIC
low complexity region 363 380 N/A INTRINSIC
low complexity region 416 425 N/A INTRINSIC
low complexity region 475 487 N/A INTRINSIC
internal_repeat_1 488 667 6.43e-5 PROSPERO
low complexity region 858 888 N/A INTRINSIC
Pfam:Ago_hook 955 1095 1.2e-28 PFAM
coiled coil region 1258 1307 N/A INTRINSIC
Pfam:TNRC6-PABC_bdg 1339 1623 2.8e-112 PFAM
Pfam:RRM_5 1641 1695 2e-7 PFAM
low complexity region 1705 1721 N/A INTRINSIC
low complexity region 1748 1769 N/A INTRINSIC
low complexity region 1792 1809 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226857
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227546
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228071
Predicted Effect probably benign
Transcript: ENSMUST00000228124
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228320
Meta Mutation Damage Score 0.076 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.9%
Validation Efficiency 96% (65/68)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit neonatal and postnatal lethality with decreased body weight and infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T G 10: 80,003,014 W674G probably damaging Het
Abcc9 G A 6: 142,692,880 H103Y probably damaging Het
Ano7 A G 1: 93,395,502 N495S probably null Het
Ash1l A G 3: 88,982,277 N488D probably benign Het
Astn2 A G 4: 65,644,882 probably benign Het
Atraid T A 5: 31,052,452 probably benign Het
Baz2b T C 2: 59,936,739 R866G probably damaging Het
Cep164 T A 9: 45,776,936 probably benign Het
Clec4f G A 6: 83,652,794 Q261* probably null Het
Cpne4 A T 9: 104,686,441 N6Y probably damaging Het
Dhx38 G T 8: 109,562,661 Q36K probably benign Het
Dna2 C A 10: 62,958,131 Q341K probably benign Het
Dynap A G 18: 70,242,094 probably benign Het
Eif3l T C 15: 79,089,609 V408A probably benign Het
Foxi3 T A 6: 70,957,138 I203N probably damaging Het
Gcc2 T A 10: 58,298,689 L1495Q probably damaging Het
Gpr158 A G 2: 21,825,208 D688G probably damaging Het
Hcfc2 C A 10: 82,739,245 T246K probably damaging Het
Hdc C T 2: 126,616,232 E57K probably benign Het
Iqsec3 G C 6: 121,412,784 probably benign Het
Islr2 T A 9: 58,199,362 E205V probably damaging Het
Klf9 T C 19: 23,142,134 L127P probably benign Het
Lamc2 A T 1: 153,124,094 L1173Q probably damaging Het
Lipe G A 7: 25,398,476 T14I possibly damaging Het
Lnpep A G 17: 17,531,132 probably benign Het
Lrrc15 A G 16: 30,273,748 S258P probably damaging Het
Macc1 A T 12: 119,447,045 Y516F probably benign Het
Megf6 A G 4: 154,259,173 T718A probably benign Het
Myh1 A G 11: 67,220,619 D1628G probably damaging Het
Naca C T 10: 128,043,293 T1398I probably benign Het
Olfr1366 A G 13: 21,537,246 F238S possibly damaging Het
Olfr441 A T 6: 43,116,216 H158L possibly damaging Het
Padi4 A G 4: 140,769,429 V52A possibly damaging Het
Paqr5 G A 9: 61,956,245 T251I probably damaging Het
Pcm1 A G 8: 41,315,930 D1611G probably damaging Het
Prss12 G A 3: 123,482,796 R358K probably benign Het
Racgap1 A T 15: 99,628,706 H325Q probably damaging Het
Rbm12b1 A G 4: 12,145,657 H543R probably benign Het
Rc3h1 A T 1: 160,967,658 N1076I probably damaging Het
Rp1 A G 1: 4,344,865 L2008P possibly damaging Het
Rsph3a A G 17: 7,946,087 H93R possibly damaging Het
Sbf1 C T 15: 89,288,712 R1840H probably damaging Het
Soga1 A G 2: 157,020,692 L1439P probably damaging Het
Svs1 T A 6: 48,988,031 D324E probably benign Het
Sytl2 T C 7: 90,403,020 probably benign Het
Tbc1d9 T C 8: 83,210,456 S56P probably damaging Het
Tiam2 A T 17: 3,511,071 M1304L probably damaging Het
Tmprss11b G T 5: 86,671,894 R9S probably damaging Het
Tnfrsf21 T A 17: 43,037,614 I39N probably benign Het
Tpra1 T C 6: 88,910,390 V217A probably benign Het
Uckl1 G C 2: 181,570,490 probably benign Het
Vmn1r199 A T 13: 22,382,566 Q10L probably benign Het
Vmn2r76 A G 7: 86,230,298 S265P possibly damaging Het
Vwa5b1 A T 4: 138,594,351 L377Q probably damaging Het
Wdr61 T A 9: 54,722,935 probably benign Het
Wrap73 A G 4: 154,145,319 D49G probably damaging Het
Zfp764 T A 7: 127,404,879 Q360L possibly damaging Het
Zfp846 G A 9: 20,587,928 probably benign Het
Zranb2 T C 3: 157,534,459 I14T probably benign Het
Other mutations in Tnrc6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01312:Tnrc6b APN 15 80923578 missense probably damaging 1.00
IGL01402:Tnrc6b APN 15 80880544 missense possibly damaging 0.71
IGL01505:Tnrc6b APN 15 80879963 missense probably benign 0.00
IGL01516:Tnrc6b APN 15 80902622 missense possibly damaging 0.93
IGL01584:Tnrc6b APN 15 80879682 missense probably benign 0.01
IGL01681:Tnrc6b APN 15 80879311 unclassified probably null
IGL01909:Tnrc6b APN 15 80901983 missense possibly damaging 0.88
IGL01943:Tnrc6b APN 15 80927695 nonsense probably null
IGL02253:Tnrc6b APN 15 80876541 missense probably damaging 0.99
IGL02260:Tnrc6b APN 15 80880171 missense probably damaging 0.99
IGL02437:Tnrc6b APN 15 80880457 missense probably damaging 1.00
IGL02541:Tnrc6b APN 15 80879831 missense probably benign 0.00
IGL02542:Tnrc6b APN 15 80902352 missense possibly damaging 0.83
PIT1430001:Tnrc6b UTSW 15 80929186 missense probably damaging 0.99
R0092:Tnrc6b UTSW 15 80918528 missense probably damaging 1.00
R0165:Tnrc6b UTSW 15 80858670 splice site probably null
R0238:Tnrc6b UTSW 15 80887864 missense probably damaging 1.00
R0238:Tnrc6b UTSW 15 80887864 missense probably damaging 1.00
R0257:Tnrc6b UTSW 15 80894355 missense possibly damaging 0.80
R0418:Tnrc6b UTSW 15 80913323 missense probably benign 0.27
R0432:Tnrc6b UTSW 15 80923446 splice site probably benign
R0487:Tnrc6b UTSW 15 80880675 missense probably benign 0.01
R0498:Tnrc6b UTSW 15 80858719 missense probably damaging 0.98
R0533:Tnrc6b UTSW 15 80876653 missense probably benign 0.00
R0571:Tnrc6b UTSW 15 80913338 missense probably damaging 1.00
R0650:Tnrc6b UTSW 15 80784758 missense probably benign 0.33
R0659:Tnrc6b UTSW 15 80923446 splice site probably benign
R0884:Tnrc6b UTSW 15 80902555 small deletion probably benign
R1131:Tnrc6b UTSW 15 80894453 missense possibly damaging 0.45
R1188:Tnrc6b UTSW 15 80879229 missense probably benign
R1479:Tnrc6b UTSW 15 80887032 unclassified probably null
R1564:Tnrc6b UTSW 15 80880168 missense possibly damaging 0.95
R1645:Tnrc6b UTSW 15 80882958 missense probably damaging 0.99
R1924:Tnrc6b UTSW 15 80884206 critical splice acceptor site probably null
R1926:Tnrc6b UTSW 15 80881162 missense probably damaging 1.00
R1928:Tnrc6b UTSW 15 80880723 missense probably damaging 1.00
R1965:Tnrc6b UTSW 15 80880439 missense probably damaging 1.00
R1966:Tnrc6b UTSW 15 80880439 missense probably damaging 1.00
R2072:Tnrc6b UTSW 15 80882965 missense possibly damaging 0.89
R3084:Tnrc6b UTSW 15 80880247 missense probably damaging 1.00
R3552:Tnrc6b UTSW 15 80880247 missense probably damaging 1.00
R3736:Tnrc6b UTSW 15 80889163 splice site probably benign
R3791:Tnrc6b UTSW 15 80923640 missense probably damaging 1.00
R4170:Tnrc6b UTSW 15 80916787 missense probably benign 0.24
R4276:Tnrc6b UTSW 15 80901971 missense probably benign 0.42
R4519:Tnrc6b UTSW 15 80880247 missense probably damaging 1.00
R5380:Tnrc6b UTSW 15 80879565 missense possibly damaging 0.56
R5470:Tnrc6b UTSW 15 80916711 missense possibly damaging 0.89
R5590:Tnrc6b UTSW 15 80876502 missense probably damaging 0.98
R5982:Tnrc6b UTSW 15 80880816 missense probably benign
R6269:Tnrc6b UTSW 15 80880743 missense probably benign 0.42
R6331:Tnrc6b UTSW 15 80879614 missense probably benign 0.00
R6484:Tnrc6b UTSW 15 80879324 missense possibly damaging 0.92
R6622:Tnrc6b UTSW 15 80879184 missense probably damaging 0.99
R6695:Tnrc6b UTSW 15 80879773 missense probably damaging 1.00
R6728:Tnrc6b UTSW 15 80918526 missense probably damaging 1.00
R6776:Tnrc6b UTSW 15 80924119 missense possibly damaging 0.87
R7159:Tnrc6b UTSW 15 80887022 missense possibly damaging 0.92
R7210:Tnrc6b UTSW 15 80929285 missense probably damaging 1.00
R7287:Tnrc6b UTSW 15 80879541 missense possibly damaging 0.83
R7402:Tnrc6b UTSW 15 80884300 missense probably damaging 1.00
R7453:Tnrc6b UTSW 15 80902555 small deletion probably benign
R7479:Tnrc6b UTSW 15 80889126 missense probably benign 0.13
X0020:Tnrc6b UTSW 15 80882997 missense probably benign 0.16
X0025:Tnrc6b UTSW 15 80881167 missense probably benign 0.03
Z1088:Tnrc6b UTSW 15 80927690 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCCAAGGCTAAGTCTGTTCAACCTC -3'
(R):5'- AGCCCATTCCAAAGGGCATTCC -3'

Sequencing Primer
(F):5'- TAAGTCTGTTCAACCTCCCAAC -3'
(R):5'- CCAAAGGGCATTCCCTTATTTTC -3'
Posted On2013-06-12