Incidental Mutation 'R6166:Thbs2'
ID490172
Institutional Source Beutler Lab
Gene Symbol Thbs2
Ensembl Gene ENSMUSG00000023885
Gene Namethrombospondin 2
SynonymsThbs-2, Thrombospondin-2, TSP2
MMRRC Submission 044312-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.208) question?
Stock #R6166 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location14665500-14694235 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 14680388 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 519 (R519H)
Ref Sequence ENSEMBL: ENSMUSP00000128308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170872]
Predicted Effect probably damaging
Transcript: ENSMUST00000170872
AA Change: R519H

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000128308
Gene: ENSMUSG00000023885
AA Change: R519H

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
TSPN 21 215 3.8e-60 SMART
VWC 320 374 3.55e-19 SMART
TSP1 384 431 3.36e-11 SMART
TSP1 440 492 1.35e-15 SMART
TSP1 497 549 8.6e-18 SMART
EGF 552 589 6.3e-3 SMART
EGF 593 647 1.56e1 SMART
EGF 651 692 2.19e-2 SMART
Pfam:TSP_3 729 764 2.5e-12 PFAM
Pfam:TSP_3 763 787 7.4e-7 PFAM
Pfam:TSP_3 788 823 9.4e-12 PFAM
Pfam:TSP_3 823 846 4.1e-7 PFAM
Pfam:TSP_3 847 884 1.7e-12 PFAM
Pfam:TSP_3 885 920 1.3e-11 PFAM
Pfam:TSP_3 921 956 3.1e-11 PFAM
Pfam:TSP_C 974 1171 1e-98 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.7%
Validation Efficiency 97% (57/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the thrombospondin family. It is a disulfide-linked homotrimeric glycoprotein that mediates cell-to-cell and cell-to-matrix interactions. This protein has been shown to function as a potent inhibitor of tumor growth and angiogenesis. Studies of the mouse counterpart suggest that this protein may modulate the cell surface properties of mesenchymal cells and be involved in cell adhesion and migration. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display premature death, abnormal tails, marked structural and functional abnormalities in a variety of connective tissues including skin, tendon, bone, and blood vessels, accelerated wound healing, and enhanced susceptibility to experimental skin tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,186,560 H478R probably benign Het
Acot2 A T 12: 83,992,604 N296Y probably damaging Het
Ago2 T A 15: 73,124,240 I347L probably benign Het
Aldh1l2 C T 10: 83,493,424 probably null Het
Ap1ar A G 3: 127,812,528 probably null Het
Arap3 T C 18: 37,974,370 T1365A probably damaging Het
Arhgef17 A T 7: 100,876,492 H1966Q probably damaging Het
Arpp21 T C 9: 112,119,198 T668A probably benign Het
Atg13 G T 2: 91,676,391 Q479K probably damaging Het
BC049730 A T 7: 24,714,219 Q220L probably benign Het
Bmp8a T C 4: 123,324,678 T183A probably benign Het
Camta2 G C 11: 70,674,261 probably null Het
Ccdc40 T C 11: 119,232,001 S210P probably benign Het
Cnn2 A G 10: 79,988,727 E17G possibly damaging Het
Cnot6l T C 5: 96,079,940 D478G possibly damaging Het
Csf2rb A G 15: 78,344,566 Y369C probably damaging Het
Dll4 A G 2: 119,334,626 probably null Het
Efcab6 A G 15: 83,896,115 V1039A probably benign Het
Fam117a T C 11: 95,380,781 M393T possibly damaging Het
Fancd2 T A 6: 113,555,251 N508K possibly damaging Het
Fat1 T C 8: 44,952,485 S758P probably damaging Het
Fgf20 T C 8: 40,279,840 K186E probably damaging Het
Filip1 T C 9: 79,819,454 K628E probably damaging Het
Fsip2 G T 2: 82,980,727 K2463N probably benign Het
Gm15446 T A 5: 109,942,780 Y299* probably null Het
Gm16432 A G 1: 178,103,837 T441A unknown Het
Gm7363 A T 7: 3,983,785 noncoding transcript Het
Gpx5 A T 13: 21,289,265 F104I probably damaging Het
Grip1 A T 10: 120,072,718 I618F probably damaging Het
Hmcn2 G A 2: 31,369,262 G1038D probably damaging Het
Lgals9 C T 11: 78,971,358 A134T probably benign Het
Lrba G A 3: 86,354,307 probably null Het
Naprt T C 15: 75,891,477 Q439R possibly damaging Het
Ndufs6 G A 13: 73,317,941 probably benign Het
Nodal C A 10: 61,424,558 S329R probably damaging Het
Olfm3 T A 3: 115,122,425 N315K probably damaging Het
Olfr420 A G 1: 174,159,093 T107A probably benign Het
Olfr730 C T 14: 50,186,768 V150I probably benign Het
Olfr803 A T 10: 129,691,279 I254K probably damaging Het
Plg T A 17: 12,398,114 V373E probably damaging Het
Prdm2 A C 4: 143,134,736 S661R probably damaging Het
Psg21 A T 7: 18,656,739 probably benign Het
Rhobtb2 T C 14: 69,798,178 D148G probably damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Scaf11 A T 15: 96,424,662 N116K probably damaging Het
Sf3a3 T C 4: 124,723,384 probably benign Homo
Slc38a9 T G 13: 112,695,267 Y184D possibly damaging Het
Sowahc A G 10: 59,222,360 D106G probably benign Het
Srbd1 T C 17: 86,099,268 Y563C probably damaging Het
Src A G 2: 157,468,522 Y359C probably damaging Het
Tbc1d9b A G 11: 50,135,846 D47G probably damaging Het
Tctn3 T C 19: 40,597,479 K541E possibly damaging Het
Tgm7 A G 2: 121,099,058 V245A probably damaging Het
Tm4sf19 T C 16: 32,407,863 S157P probably damaging Het
Trio C T 15: 27,818,071 S507N probably damaging Het
Trrap T A 5: 144,781,981 H152Q possibly damaging Het
Vmn2r56 A G 7: 12,694,020 L773P probably damaging Het
Vmn2r70 A G 7: 85,565,981 L115P probably benign Het
Wdr59 C T 8: 111,472,661 R631H probably damaging Het
Other mutations in Thbs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Thbs2 APN 17 14668835 missense probably damaging 1.00
IGL00764:Thbs2 APN 17 14690252 missense probably damaging 0.98
IGL01370:Thbs2 APN 17 14690065 missense possibly damaging 0.82
IGL01604:Thbs2 APN 17 14678769 missense probably benign 0.31
IGL01936:Thbs2 APN 17 14687814 missense probably benign 0.00
IGL02061:Thbs2 APN 17 14679914 missense probably benign 0.35
IGL02255:Thbs2 APN 17 14689785 missense probably benign 0.00
IGL02342:Thbs2 APN 17 14676316 missense probably damaging 1.00
IGL02402:Thbs2 APN 17 14671454 missense probably benign 0.01
IGL02499:Thbs2 APN 17 14684066 splice site probably benign
IGL02572:Thbs2 APN 17 14677013 missense possibly damaging 0.72
IGL02701:Thbs2 APN 17 14683361 missense probably benign 0.05
IGL02871:Thbs2 APN 17 14685786 missense probably benign
IGL03058:Thbs2 APN 17 14689969 missense possibly damaging 0.91
IGL03185:Thbs2 APN 17 14681410 nonsense probably null
IGL03232:Thbs2 APN 17 14691413 start codon destroyed probably null
IGL03289:Thbs2 APN 17 14690122 missense probably benign 0.00
IGL03407:Thbs2 APN 17 14673273 missense probably benign 0.00
H8562:Thbs2 UTSW 17 14671453 missense probably benign 0.00
IGL02802:Thbs2 UTSW 17 14684127 missense probably benign 0.01
PIT4354001:Thbs2 UTSW 17 14689968 missense probably damaging 0.99
R0088:Thbs2 UTSW 17 14681701 missense possibly damaging 0.96
R0167:Thbs2 UTSW 17 14667525 splice site probably benign
R0415:Thbs2 UTSW 17 14679973 missense probably benign
R0658:Thbs2 UTSW 17 14680325 missense probably benign 0.00
R0735:Thbs2 UTSW 17 14679815 missense probably benign 0.00
R1582:Thbs2 UTSW 17 14671288 missense probably damaging 1.00
R1585:Thbs2 UTSW 17 14689768 missense probably benign 0.00
R1608:Thbs2 UTSW 17 14685781 missense probably benign
R1721:Thbs2 UTSW 17 14678810 missense probably benign 0.00
R1724:Thbs2 UTSW 17 14685900 missense possibly damaging 0.80
R1791:Thbs2 UTSW 17 14685813 missense probably benign
R1816:Thbs2 UTSW 17 14670713 missense probably benign 0.01
R1816:Thbs2 UTSW 17 14670714 missense probably benign 0.00
R1911:Thbs2 UTSW 17 14689842 missense probably benign 0.38
R2137:Thbs2 UTSW 17 14673306 missense probably damaging 1.00
R2152:Thbs2 UTSW 17 14673209 missense probably damaging 1.00
R2244:Thbs2 UTSW 17 14671413 missense probably damaging 1.00
R2325:Thbs2 UTSW 17 14690289 splice site probably null
R2509:Thbs2 UTSW 17 14685843 missense probably benign 0.11
R3838:Thbs2 UTSW 17 14687851 missense probably benign
R4173:Thbs2 UTSW 17 14681631 intron probably null
R4427:Thbs2 UTSW 17 14680335 missense probably benign
R4495:Thbs2 UTSW 17 14671413 missense probably damaging 1.00
R4789:Thbs2 UTSW 17 14671488 missense probably damaging 1.00
R4928:Thbs2 UTSW 17 14678900 missense probably damaging 1.00
R5058:Thbs2 UTSW 17 14676329 missense probably damaging 1.00
R5112:Thbs2 UTSW 17 14670590 splice site probably null
R5619:Thbs2 UTSW 17 14681244 missense probably damaging 1.00
R5649:Thbs2 UTSW 17 14689953 missense probably damaging 1.00
R5664:Thbs2 UTSW 17 14689837 missense probably damaging 1.00
R5801:Thbs2 UTSW 17 14687863 missense probably damaging 1.00
R5816:Thbs2 UTSW 17 14684071 critical splice donor site probably null
R5840:Thbs2 UTSW 17 14681430 splice site probably null
R6149:Thbs2 UTSW 17 14679680 critical splice donor site probably null
R6412:Thbs2 UTSW 17 14677077 missense probably damaging 1.00
R6473:Thbs2 UTSW 17 14685796 missense probably benign 0.23
R6640:Thbs2 UTSW 17 14673368 missense possibly damaging 0.94
R6695:Thbs2 UTSW 17 14674164 missense possibly damaging 0.54
R6711:Thbs2 UTSW 17 14690265 missense probably benign 0.00
R6947:Thbs2 UTSW 17 14689767 missense possibly damaging 0.79
R6962:Thbs2 UTSW 17 14681820 missense probably benign 0.00
R7183:Thbs2 UTSW 17 14690116 missense possibly damaging 0.90
R7203:Thbs2 UTSW 17 14671458 missense probably damaging 1.00
S24628:Thbs2 UTSW 17 14679973 missense probably benign
X0025:Thbs2 UTSW 17 14681800 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGTATGCATGCCCTGTCACC -3'
(R):5'- GTAAATCACAGTAGACCAGTCCTC -3'

Sequencing Primer
(F):5'- TGCCCTGTCACCCATGGAAC -3'
(R):5'- GTGTCTTCAACTACACTGGAATAGCC -3'
Posted On2017-10-10