Incidental Mutation 'R6167:Slc25a19'
ID490207
Institutional Source Beutler Lab
Gene Symbol Slc25a19
Ensembl Gene ENSMUSG00000020744
Gene Namesolute carrier family 25 (mitochondrial thiamine pyrophosphate carrier), member 19
Synonyms2900089E13Rik, DNC, MUP1, TPC
MMRRC Submission 044313-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6167 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location115614178-115628295 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 115615551 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 272 (V272A)
Ref Sequence ENSEMBL: ENSMUSP00000137534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021087] [ENSMUST00000021089] [ENSMUST00000106503] [ENSMUST00000106506] [ENSMUST00000106507] [ENSMUST00000135552] [ENSMUST00000148574] [ENSMUST00000178003]
Predicted Effect probably benign
Transcript: ENSMUST00000021087
SMART Domains Protein: ENSMUSP00000021087
Gene: ENSMUSG00000020743

DomainStartEndE-ValueType
Pfam:MIF4G 4 205 1.4e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000021089
AA Change: V272A

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000021089
Gene: ENSMUSG00000020744
AA Change: V272A

DomainStartEndE-ValueType
Pfam:Mito_carr 12 111 5.7e-20 PFAM
Pfam:Mito_carr 114 205 5.3e-24 PFAM
Pfam:Mito_carr 212 313 5.2e-23 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000106503
AA Change: Y211H
SMART Domains Protein: ENSMUSP00000102112
Gene: ENSMUSG00000020744
AA Change: Y211H

DomainStartEndE-ValueType
Pfam:Mito_carr 11 111 1.7e-22 PFAM
Pfam:Mito_carr 114 172 9.7e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106506
SMART Domains Protein: ENSMUSP00000102115
Gene: ENSMUSG00000020743

DomainStartEndE-ValueType
Pfam:MIF4G 4 186 1.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106507
SMART Domains Protein: ENSMUSP00000102116
Gene: ENSMUSG00000020743

DomainStartEndE-ValueType
Pfam:MIF4G 4 204 3.5e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124407
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127132
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129194
Predicted Effect unknown
Transcript: ENSMUST00000135552
AA Change: V189A
SMART Domains Protein: ENSMUSP00000114566
Gene: ENSMUSG00000020744
AA Change: V189A

DomainStartEndE-ValueType
Pfam:Mito_carr 31 122 1.1e-25 PFAM
Pfam:Mito_carr 129 226 4.7e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137304
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139556
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142637
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144083
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146244
Predicted Effect probably benign
Transcript: ENSMUST00000148574
SMART Domains Protein: ENSMUSP00000119643
Gene: ENSMUSG00000020743

DomainStartEndE-ValueType
Pfam:MIF4G 4 162 1.3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178003
AA Change: V272A

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000137534
Gene: ENSMUSG00000020744
AA Change: V272A

DomainStartEndE-ValueType
Pfam:Mito_carr 11 111 1.1e-21 PFAM
Pfam:Mito_carr 114 205 7e-25 PFAM
Pfam:Mito_carr 212 313 1e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180919
Meta Mutation Damage Score 0.114 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.8%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial protein that is a member of the solute carrier family. Although this protein was initially thought to be the mitochondrial deoxynucleotide carrier involved in the uptake of deoxynucleotides into the matrix of the mitochondria, further studies have demonstrated that this protein instead functions as the mitochondrial thiamine pyrophosphate carrier, which transports thiamine pyrophosphates into mitochondria. Mutations in this gene cause microcephaly, Amish type, a metabolic disease that results in severe congenital microcephaly, severe 2-ketoglutaric aciduria, and death within the first year. Multiple alternatively spliced variants, encoding the same protein, have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in lethality by E12, neural tube closure defects resulting in exencephaly and microcephaly, growth arrest, anemia, elevated alpha-ketoglutarate in amniotic fluid, and reduced thiamine pyrophosphate content in mitochondria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 T A 11: 110,292,105 E1042V probably benign Het
Ahnak2 T C 12: 112,783,122 E1035G probably benign Het
Aip T G 19: 4,115,188 D227A probably benign Het
Ankrd13d T C 19: 4,273,053 H283R probably damaging Het
Aox4 C T 1: 58,263,935 T1175I probably damaging Het
Atn1 T C 6: 124,746,737 probably benign Het
Camkk2 A G 5: 122,764,124 S41P probably damaging Het
Ceacam16 G A 7: 19,861,257 probably benign Het
Dcaf15 T C 8: 84,097,997 N524D possibly damaging Het
Dcaf7 A T 11: 106,037,251 Y43F probably damaging Het
Epha3 T C 16: 63,612,924 I453V probably benign Het
Etv1 A T 12: 38,865,641 T413S possibly damaging Het
Evx2 A C 2: 74,659,262 L53R probably damaging Het
Fam168b G A 1: 34,819,603 A166V probably damaging Het
Fancm A T 12: 65,094,895 Y430F probably benign Het
Fyb2 A G 4: 104,945,464 T188A possibly damaging Het
Gabbr1 T C 17: 37,063,379 I538T probably damaging Het
Glyctk T A 9: 106,156,492 T208S possibly damaging Het
Golga7 T C 8: 23,245,888 D114G probably damaging Het
Grip1 T C 10: 119,897,797 probably null Het
Gtf2f1 G T 17: 57,004,161 S351R probably damaging Het
Hook2 T C 8: 84,995,013 L300P probably damaging Het
Hsf4 A G 8: 105,270,849 S45G probably damaging Het
Iars T A 13: 49,722,714 M825K probably damaging Het
Kcnj2 A G 11: 111,072,489 I236V probably benign Het
Large2 G A 2: 92,367,088 T354I probably benign Het
Mak C A 13: 41,053,352 V101F probably benign Het
Mylk2 A G 2: 152,915,753 probably null Het
Myo18b A T 5: 112,872,507 probably null Het
Neb T A 2: 52,147,237 H2955L probably benign Het
Neurl1a G C 19: 47,239,928 G71A probably damaging Het
Ogfrl1 A T 1: 23,376,228 L142Q probably damaging Het
Olfr387-ps1 A G 11: 73,665,334 T242A probably damaging Het
Olfr743 C A 14: 50,534,155 H248N probably damaging Het
P3h4 C A 11: 100,411,845 A322S probably damaging Het
Piwil2 A C 14: 70,422,893 probably null Het
Pkd2l2 A G 18: 34,428,244 D435G probably damaging Het
Plekha6 A G 1: 133,279,407 N567S probably null Het
Prss54 G A 8: 95,559,545 P300L possibly damaging Het
Pxdn G A 12: 29,974,001 R67Q probably damaging Het
Rapgef3 C A 15: 97,767,411 probably benign Het
Sec24b C T 3: 129,988,901 G1147S possibly damaging Het
Sh2b3 A T 5: 121,828,355 probably null Het
Sh3glb1 A T 3: 144,691,903 D358E probably damaging Het
Shmt2 C T 10: 127,517,862 R478H probably benign Het
Slc1a6 A G 10: 78,801,837 E399G probably benign Het
Slc22a23 T A 13: 34,344,559 Y80F probably damaging Het
Stk32a A T 18: 43,313,409 D308V probably damaging Het
Tenm3 T C 8: 48,254,622 I1698V possibly damaging Het
Thoc5 G A 11: 4,915,497 V359M probably benign Het
Tmpo C T 10: 91,162,938 R329H probably benign Het
Trim8 T C 19: 46,515,187 S393P probably benign Het
Vill A T 9: 119,066,864 Y103F probably damaging Het
Zfp948 T G 17: 21,587,649 F368V probably benign Het
Zpld1 C T 16: 55,233,599 E277K probably damaging Het
Other mutations in Slc25a19
AlleleSourceChrCoordTypePredicted EffectPPH Score
Baggins UTSW 11 115617560 missense possibly damaging 0.91
PIT4498001:Slc25a19 UTSW 11 115623955 missense possibly damaging 0.80
R0335:Slc25a19 UTSW 11 115624206 missense probably damaging 1.00
R0398:Slc25a19 UTSW 11 115617575 missense probably damaging 1.00
R0454:Slc25a19 UTSW 11 115617597 nonsense probably null
R1614:Slc25a19 UTSW 11 115616623 nonsense probably null
R3775:Slc25a19 UTSW 11 115615459 missense probably damaging 1.00
R3776:Slc25a19 UTSW 11 115615459 missense probably damaging 1.00
R5000:Slc25a19 UTSW 11 115616671 intron probably null
R5593:Slc25a19 UTSW 11 115616592 missense probably damaging 1.00
R5738:Slc25a19 UTSW 11 115624234 missense probably benign 0.24
R6306:Slc25a19 UTSW 11 115617560 missense possibly damaging 0.91
R7014:Slc25a19 UTSW 11 115620966 missense probably damaging 1.00
R7161:Slc25a19 UTSW 11 115616547 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- ATGAGCTCAGAGCCAAGTCTTG -3'
(R):5'- CCCTTCCTCAGTTAGCAGCATG -3'

Sequencing Primer
(F):5'- TCAGAGCCAAGTCTTGTCGGG -3'
(R):5'- TGCATTAGAAAGAGTGAGGAGCTCC -3'
Posted On2017-10-10