Incidental Mutation 'R6167:Neurl1a'
ID490228
Institutional Source Beutler Lab
Gene Symbol Neurl1a
Ensembl Gene ENSMUSG00000006435
Gene Nameneuralized E3 ubiquitin protein ligase 1A
SynonymsNeur1, Rnf67, Neurl, Neu1, Nlz, 2410129E16Rik
MMRRC Submission 044313-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.296) question?
Stock #R6167 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location47178820-47259440 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 47239928 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Alanine at position 71 (G71A)
Ref Sequence ENSEMBL: ENSMUSP00000107439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111807] [ENSMUST00000111808]
Predicted Effect probably damaging
Transcript: ENSMUST00000111807
AA Change: G54A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107438
Gene: ENSMUSG00000006435
AA Change: G54A

DomainStartEndE-ValueType
NEUZ 43 166 8.33e-66 SMART
Blast:NEUZ 186 213 1e-8 BLAST
low complexity region 241 253 N/A INTRINSIC
NEUZ 274 397 1.79e-56 SMART
low complexity region 440 456 N/A INTRINSIC
low complexity region 469 482 N/A INTRINSIC
RING 504 543 2.22e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111808
AA Change: G71A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107439
Gene: ENSMUSG00000006435
AA Change: G71A

DomainStartEndE-ValueType
NEUZ 60 183 8.33e-66 SMART
Blast:NEUZ 203 230 9e-9 BLAST
low complexity region 258 270 N/A INTRINSIC
NEUZ 291 414 1.79e-56 SMART
low complexity region 457 473 N/A INTRINSIC
low complexity region 486 499 N/A INTRINSIC
RING 521 560 2.22e-2 SMART
Meta Mutation Damage Score 0.32 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.8%
Validation Efficiency 98% (50/51)
MGI Phenotype PHENOTYPE: Depending on the targeted mutation, homozygotes show a spectrum of conflicting phenotypes ranging from axonemal and spermatid abnormalities, male sterility and deficient lactation, to just a specific olfactory discrimination defect and ethanol hypersensitivity on motor coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 T A 11: 110,292,105 E1042V probably benign Het
Ahnak2 T C 12: 112,783,122 E1035G probably benign Het
Aip T G 19: 4,115,188 D227A probably benign Het
Ankrd13d T C 19: 4,273,053 H283R probably damaging Het
Aox4 C T 1: 58,263,935 T1175I probably damaging Het
Atn1 T C 6: 124,746,737 probably benign Het
Camkk2 A G 5: 122,764,124 S41P probably damaging Het
Ceacam16 G A 7: 19,861,257 probably benign Het
Dcaf15 T C 8: 84,097,997 N524D possibly damaging Het
Dcaf7 A T 11: 106,037,251 Y43F probably damaging Het
Epha3 T C 16: 63,612,924 I453V probably benign Het
Etv1 A T 12: 38,865,641 T413S possibly damaging Het
Evx2 A C 2: 74,659,262 L53R probably damaging Het
Fam168b G A 1: 34,819,603 A166V probably damaging Het
Fancm A T 12: 65,094,895 Y430F probably benign Het
Fyb2 A G 4: 104,945,464 T188A possibly damaging Het
Gabbr1 T C 17: 37,063,379 I538T probably damaging Het
Glyctk T A 9: 106,156,492 T208S possibly damaging Het
Golga7 T C 8: 23,245,888 D114G probably damaging Het
Grip1 T C 10: 119,897,797 probably null Het
Gtf2f1 G T 17: 57,004,161 S351R probably damaging Het
Hook2 T C 8: 84,995,013 L300P probably damaging Het
Hsf4 A G 8: 105,270,849 S45G probably damaging Het
Iars T A 13: 49,722,714 M825K probably damaging Het
Kcnj2 A G 11: 111,072,489 I236V probably benign Het
Large2 G A 2: 92,367,088 T354I probably benign Het
Mak C A 13: 41,053,352 V101F probably benign Het
Mylk2 A G 2: 152,915,753 probably null Het
Myo18b A T 5: 112,872,507 probably null Het
Neb T A 2: 52,147,237 H2955L probably benign Het
Ogfrl1 A T 1: 23,376,228 L142Q probably damaging Het
Olfr387-ps1 A G 11: 73,665,334 T242A probably damaging Het
Olfr743 C A 14: 50,534,155 H248N probably damaging Het
P3h4 C A 11: 100,411,845 A322S probably damaging Het
Piwil2 A C 14: 70,422,893 probably null Het
Pkd2l2 A G 18: 34,428,244 D435G probably damaging Het
Plekha6 A G 1: 133,279,407 N567S probably null Het
Prss54 G A 8: 95,559,545 P300L possibly damaging Het
Pxdn G A 12: 29,974,001 R67Q probably damaging Het
Rapgef3 C A 15: 97,767,411 probably benign Het
Sec24b C T 3: 129,988,901 G1147S possibly damaging Het
Sh2b3 A T 5: 121,828,355 probably null Het
Sh3glb1 A T 3: 144,691,903 D358E probably damaging Het
Shmt2 C T 10: 127,517,862 R478H probably benign Het
Slc1a6 A G 10: 78,801,837 E399G probably benign Het
Slc22a23 T A 13: 34,344,559 Y80F probably damaging Het
Slc25a19 A G 11: 115,615,551 V272A probably benign Het
Stk32a A T 18: 43,313,409 D308V probably damaging Het
Tenm3 T C 8: 48,254,622 I1698V possibly damaging Het
Thoc5 G A 11: 4,915,497 V359M probably benign Het
Tmpo C T 10: 91,162,938 R329H probably benign Het
Trim8 T C 19: 46,515,187 S393P probably benign Het
Vill A T 9: 119,066,864 Y103F probably damaging Het
Zfp948 T G 17: 21,587,649 F368V probably benign Het
Zpld1 C T 16: 55,233,599 E277K probably damaging Het
Other mutations in Neurl1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03186:Neurl1a APN 19 47240477 missense probably damaging 0.99
R1403:Neurl1a UTSW 19 47253711 missense probably damaging 1.00
R1822:Neurl1a UTSW 19 47257459 missense probably benign 0.16
R3040:Neurl1a UTSW 19 47239831 missense probably benign 0.00
R3435:Neurl1a UTSW 19 47257525 missense probably damaging 1.00
R3767:Neurl1a UTSW 19 47239889 missense probably damaging 1.00
R3770:Neurl1a UTSW 19 47239889 missense probably damaging 1.00
R3884:Neurl1a UTSW 19 47253446 missense probably benign 0.30
R4539:Neurl1a UTSW 19 47256744 missense probably damaging 1.00
R5108:Neurl1a UTSW 19 47257635 missense probably damaging 1.00
R5644:Neurl1a UTSW 19 47179477 missense probably benign
X0063:Neurl1a UTSW 19 47253674 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- GACCCCAATCTGTCTCTTGG -3'
(R):5'- AATCTTGCTACCCAGGAAGGC -3'

Sequencing Primer
(F):5'- GGTCCTATTACATTCTCTGACGC -3'
(R):5'- CTGGTAGTGGAACAGCAGACC -3'
Posted On2017-10-10