Incidental Mutation 'R6168:Ahnak2'
ID490266
Institutional Source Beutler Lab
Gene Symbol Ahnak2
Ensembl Gene ENSMUSG00000072812
Gene NameAHNAK nucleoprotein 2
SynonymsLOC382643
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R6168 (G1)
Quality Score89.0077
Status Not validated
Chromosome12
Chromosomal Location112772194-112802657 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 112783122 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1035 (E1035G)
Ref Sequence ENSEMBL: ENSMUSP00000114522 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124526]
Predicted Effect probably benign
Transcript: ENSMUST00000124526
AA Change: E1035G

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000114522
Gene: ENSMUSG00000072812
AA Change: E1035G

DomainStartEndE-ValueType
low complexity region 73 94 N/A INTRINSIC
PDZ 118 190 6e-4 SMART
low complexity region 268 281 N/A INTRINSIC
low complexity region 300 319 N/A INTRINSIC
low complexity region 405 429 N/A INTRINSIC
internal_repeat_1 465 898 2.74e-235 PROSPERO
low complexity region 905 923 N/A INTRINSIC
low complexity region 990 1013 N/A INTRINSIC
low complexity region 1076 1092 N/A INTRINSIC
internal_repeat_1 1145 1588 2.74e-235 PROSPERO
low complexity region 1590 1632 N/A INTRINSIC
low complexity region 1639 1700 N/A INTRINSIC
low complexity region 1709 1736 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137195
SMART Domains Protein: ENSMUSP00000116582
Gene: ENSMUSG00000072812

DomainStartEndE-ValueType
internal_repeat_1 2 521 3.81e-221 PROSPERO
low complexity region 557 569 N/A INTRINSIC
internal_repeat_1 606 1126 3.81e-221 PROSPERO
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik T C 19: 7,422,940 V257A probably benign Het
4932414N04Rik C T 2: 68,741,483 L568F possibly damaging Het
8030462N17Rik A G 18: 77,673,957 S220P probably damaging Het
Adam3 A T 8: 24,681,614 probably null Het
Adamts13 G T 2: 27,004,886 A1069S probably benign Het
Adarb1 A G 10: 77,322,319 L98P probably damaging Het
Alox12b T A 11: 69,169,634 I672N probably damaging Het
Ash1l C T 3: 89,052,773 R2271* probably null Het
Atf7ip A G 6: 136,559,819 T17A probably damaging Het
Col6a5 A G 9: 105,875,787 probably null Het
Crcp A G 5: 130,037,896 N41S probably damaging Het
Defb15 A C 8: 21,930,053 N19K possibly damaging Het
Dnah7a T A 1: 53,411,568 D3901V probably damaging Het
Dnah7b A C 1: 46,290,703 T3236P probably damaging Het
Dnmbp A G 19: 43,850,240 S608P probably damaging Het
Efcab12 T C 6: 115,814,616 K532E probably damaging Het
Fbrsl1 C T 5: 110,396,056 V54M probably damaging Het
Gm14496 T A 2: 182,000,957 V807E probably damaging Het
Hoxa2 A G 6: 52,163,481 L175P probably damaging Het
Igkv4-58 A C 6: 69,500,297 D105E probably damaging Het
Igkv8-27 A T 6: 70,171,896 S91R probably benign Het
Itgax T C 7: 128,133,097 V175A probably damaging Het
Kcnc2 A G 10: 112,455,756 D283G probably benign Het
Lepr G A 4: 101,735,592 G135R probably damaging Het
Mcf2l A G 8: 13,001,823 S378G probably benign Het
Mta1 T A 12: 113,123,119 D145E probably damaging Het
Nkd1 T A 8: 88,585,231 N44K probably damaging Het
Notch2 A G 3: 98,145,217 K2010E probably damaging Het
Nsd3 G A 8: 25,691,161 G930S probably null Het
Olfr1047 T G 2: 86,228,594 I126L probably damaging Het
Olfr263 T G 13: 21,133,229 I151M possibly damaging Het
Olfr52 T C 2: 86,181,965 I49V probably damaging Het
Olfr772 A G 10: 129,174,166 F285S probably damaging Het
Olfr955 A G 9: 39,470,657 L23P probably damaging Het
Pde4c G A 8: 70,750,039 E625K probably benign Het
Pdgfb T C 15: 80,000,386 T151A probably benign Het
Pik3r5 T C 11: 68,492,675 V440A probably benign Het
Piwil2 T C 14: 70,395,351 T591A probably benign Het
Ppm1l A G 3: 69,549,407 D219G probably damaging Het
Psmc6 T C 14: 45,343,683 I312T probably damaging Het
Rasl10a T C 11: 5,058,442 V46A possibly damaging Het
Rhov T C 2: 119,270,972 Y51C probably damaging Het
S100a16 C T 3: 90,542,572 Q121* probably null Het
Slc5a12 T C 2: 110,616,744 V199A probably damaging Het
Slc6a7 A T 18: 61,001,662 M447K probably benign Het
Tarbp1 A G 8: 126,448,405 V764A possibly damaging Het
Vmn1r197 T C 13: 22,328,508 Y200H possibly damaging Het
Vmn2r102 G A 17: 19,694,140 A656T possibly damaging Het
Vmn2r49 G T 7: 9,984,786 D450E probably benign Het
Wdr7 T A 18: 63,777,977 N813K probably damaging Het
Yeats2 T C 16: 20,179,558 S288P probably benign Het
Zswim6 G A 13: 107,787,764 noncoding transcript Het
Other mutations in Ahnak2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02257:Ahnak2 APN 12 112785285 missense possibly damaging 0.79
IGL02994:Ahnak2 APN 12 112786207 missense probably damaging 0.99
PIT4480001:Ahnak2 UTSW 12 112773924 missense possibly damaging 0.79
PIT4810001:Ahnak2 UTSW 12 112785594 missense
R0025:Ahnak2 UTSW 12 112785534 missense probably damaging 0.99
R0025:Ahnak2 UTSW 12 112785534 missense probably damaging 0.99
R0038:Ahnak2 UTSW 12 112774462 missense probably benign 0.00
R0125:Ahnak2 UTSW 12 112785156 missense probably benign 0.41
R1173:Ahnak2 UTSW 12 112785789 missense probably damaging 1.00
R1494:Ahnak2 UTSW 12 112787950 missense probably damaging 1.00
R1712:Ahnak2 UTSW 12 112785378 missense probably benign 0.05
R1888:Ahnak2 UTSW 12 112773891 missense possibly damaging 0.49
R1888:Ahnak2 UTSW 12 112773891 missense possibly damaging 0.49
R2042:Ahnak2 UTSW 12 112785819 missense probably damaging 0.98
R2056:Ahnak2 UTSW 12 112785006 missense probably benign 0.00
R2417:Ahnak2 UTSW 12 112775371 missense probably damaging 1.00
R2762:Ahnak2 UTSW 12 112785364 missense probably damaging 0.96
R3618:Ahnak2 UTSW 12 112786222 missense probably damaging 1.00
R3706:Ahnak2 UTSW 12 112773651 missense possibly damaging 0.74
R3739:Ahnak2 UTSW 12 112774558 missense probably benign 0.05
R3950:Ahnak2 UTSW 12 112785789 missense probably damaging 1.00
R4485:Ahnak2 UTSW 12 112779767 unclassified probably benign
R4651:Ahnak2 UTSW 12 112774837 missense possibly damaging 0.93
R4652:Ahnak2 UTSW 12 112774837 missense possibly damaging 0.93
R4831:Ahnak2 UTSW 12 112775749 missense probably damaging 0.99
R4836:Ahnak2 UTSW 12 112774116 missense probably damaging 1.00
R4837:Ahnak2 UTSW 12 112785739 missense probably benign 0.00
R4864:Ahnak2 UTSW 12 112773606 missense probably damaging 0.98
R4908:Ahnak2 UTSW 12 112775272 missense probably benign 0.00
R5067:Ahnak2 UTSW 12 112785316 missense probably benign 0.01
R5146:Ahnak2 UTSW 12 112775726 missense probably benign 0.00
R5228:Ahnak2 UTSW 12 112775386 missense probably benign 0.03
R5255:Ahnak2 UTSW 12 112773378 missense possibly damaging 0.92
R5323:Ahnak2 UTSW 12 112779812 unclassified probably benign
R5523:Ahnak2 UTSW 12 112775208 missense probably damaging 1.00
R5733:Ahnak2 UTSW 12 112775666 nonsense probably null
R5799:Ahnak2 UTSW 12 112778930 unclassified probably benign
R5817:Ahnak2 UTSW 12 112774003 missense probably damaging 1.00
R5835:Ahnak2 UTSW 12 112775796 missense possibly damaging 0.66
R6083:Ahnak2 UTSW 12 112782612 missense probably benign 0.06
R6083:Ahnak2 UTSW 12 112782999 missense probably benign 0.01
R6167:Ahnak2 UTSW 12 112783122 missense probably benign 0.03
R6405:Ahnak2 UTSW 12 112773337 missense probably damaging 1.00
R6460:Ahnak2 UTSW 12 112786990 missense probably null 0.27
R6495:Ahnak2 UTSW 12 112773714 missense probably damaging 1.00
R6544:Ahnak2 UTSW 12 112780652 unclassified probably benign
R6656:Ahnak2 UTSW 12 112785371 missense probably benign 0.02
R6679:Ahnak2 UTSW 12 112772976 missense probably damaging 1.00
R6723:Ahnak2 UTSW 12 112778793 missense probably damaging 1.00
R6774:Ahnak2 UTSW 12 112773738 missense possibly damaging 0.87
R6884:Ahnak2 UTSW 12 112775429 missense possibly damaging 0.81
R6906:Ahnak2 UTSW 12 112785313 missense probably benign 0.00
R6919:Ahnak2 UTSW 12 112774684 missense possibly damaging 0.55
R7036:Ahnak2 UTSW 12 112778781 unclassified probably benign
R7037:Ahnak2 UTSW 12 112774278 missense probably damaging 0.99
R7064:Ahnak2 UTSW 12 112780742 unclassified probably benign
R7072:Ahnak2 UTSW 12 112788166 missense
R7112:Ahnak2 UTSW 12 112783119 missense
R7268:Ahnak2 UTSW 12 112780802 missense
R7269:Ahnak2 UTSW 12 112780802 missense
R7270:Ahnak2 UTSW 12 112780802 missense
R7271:Ahnak2 UTSW 12 112780802 missense
R7444:Ahnak2 UTSW 12 112781208 missense
R7448:Ahnak2 UTSW 12 112782502 missense
R7488:Ahnak2 UTSW 12 112785021 missense
Predicted Primers PCR Primer
(F):5'- GAACTTGCTGTCTTTGGCC -3'
(R):5'- TCAAGATGCCCAAGGTGGAC -3'

Sequencing Primer
(F):5'- GTCCACCTTGGGCATCTTGAG -3'
(R):5'- ACCTGAAGGGCCCCAAAGTG -3'
Posted On2017-10-10