Mutagenetix > Incidental Mutation

Incidental Mutation 'R6168:Zswim6'

490270

Institutional Source

Beutler Lab

Gene Symbol

Zswim6

Ensembl Gene

ENSMUSG00000032846

Gene Name

zinc finger SWIM-type containing 6

Synonyms

2900036G02Rik

MMRRC Submission

044430-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.436) question?

Stock #

R6168 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

107861152-108026598 bp(-) (GRCm39)

Type of Mutation

exon

DNA Base Change (assembly)

G to A at 107924299 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s):

AlphaFold

no structure available at present

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000105097

SMART Domains

Protein: ENSMUSP00000100724
Gene: ENSMUSG00000032846

Domain	Start	End	E-Value	Type
low complexity region	19	39	N/A	INTRINSIC
low complexity region	43	71	N/A	INTRINSIC
low complexity region	132	193	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225822

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 95.1%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial postnatal lethality, decreased striatal volume, abnormal medium spiny neuron morphology, and altered motor control including hyperactivity, impaired rotarod performance, repetitive movements, and behavioral hyperresponsiveness to amphetamine. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932414N04Rik	C	T	2: 68,571,827 (GRCm39)	L568F	possibly damaging	Het
Adam3	A	T	8: 25,171,630 (GRCm39)		probably null	Het
Adamts13	G	T	2: 26,894,898 (GRCm39)	A1069S	probably benign	Het
Adarb1	A	G	10: 77,158,153 (GRCm39)	L98P	probably damaging	Het
Ahnak2	T	C	12: 112,747,750 (GRCm39)	E1035G	probably benign	Het
Alox12b	T	A	11: 69,060,460 (GRCm39)	I672N	probably damaging	Het
Ark2n	A	G	18: 77,761,653 (GRCm39)	S220P	probably damaging	Het
Ash1l	C	T	3: 88,960,080 (GRCm39)	R2271*	probably null	Het
Atf7ip	A	G	6: 136,536,817 (GRCm39)	T17A	probably damaging	Het
Col6a5	A	G	9: 105,752,986 (GRCm39)		probably null	Het
Crcp	A	G	5: 130,066,737 (GRCm39)	N41S	probably damaging	Het
Defb15	A	C	8: 22,420,069 (GRCm39)	N19K	possibly damaging	Het
Dnah7a	T	A	1: 53,450,727 (GRCm39)	D3901V	probably damaging	Het
Dnah7b	A	C	1: 46,329,863 (GRCm39)	T3236P	probably damaging	Het
Dnmbp	A	G	19: 43,838,679 (GRCm39)	S608P	probably damaging	Het
Efcab12	T	C	6: 115,791,577 (GRCm39)	K532E	probably damaging	Het
Fbrsl1	C	T	5: 110,543,922 (GRCm39)	V54M	probably damaging	Het
Gm14496	T	A	2: 181,642,750 (GRCm39)	V807E	probably damaging	Het
Hoxa2	A	G	6: 52,140,461 (GRCm39)	L175P	probably damaging	Het
Igkv4-58	A	C	6: 69,477,281 (GRCm39)	D105E	probably damaging	Het
Igkv8-27	A	T	6: 70,148,880 (GRCm39)	S91R	probably benign	Het
Itgax	T	C	7: 127,732,269 (GRCm39)	V175A	probably damaging	Het
Kcnc2	A	G	10: 112,291,661 (GRCm39)	D283G	probably benign	Het
Lepr	G	A	4: 101,592,789 (GRCm39)	G135R	probably damaging	Het
Mcf2l	A	G	8: 13,051,823 (GRCm39)	S378G	probably benign	Het
Mta1	T	A	12: 113,086,739 (GRCm39)	D145E	probably damaging	Het
Nkd1	T	A	8: 89,311,859 (GRCm39)	N44K	probably damaging	Het
Notch2	A	G	3: 98,052,533 (GRCm39)	K2010E	probably damaging	Het
Nsd3	G	A	8: 26,181,188 (GRCm39)	G930S	probably null	Het
Or2w1	T	G	13: 21,317,399 (GRCm39)	I151M	possibly damaging	Het
Or6c203	A	G	10: 129,010,035 (GRCm39)	F285S	probably damaging	Het
Or8g35	A	G	9: 39,381,953 (GRCm39)	L23P	probably damaging	Het
Or8k3	T	G	2: 86,058,938 (GRCm39)	I126L	probably damaging	Het
Or8u8	T	C	2: 86,012,309 (GRCm39)	I49V	probably damaging	Het
Pde4c	G	A	8: 71,202,688 (GRCm39)	E625K	probably benign	Het
Pdgfb	T	C	15: 79,884,587 (GRCm39)	T151A	probably benign	Het
Pik3r5	T	C	11: 68,383,501 (GRCm39)	V440A	probably benign	Het
Piwil2	T	C	14: 70,632,800 (GRCm39)	T591A	probably benign	Het
Ppm1l	A	G	3: 69,456,740 (GRCm39)	D219G	probably damaging	Het
Psmc6	T	C	14: 45,581,140 (GRCm39)	I312T	probably damaging	Het
Rasl10a	T	C	11: 5,008,442 (GRCm39)	V46A	possibly damaging	Het
Rhov	T	C	2: 119,101,453 (GRCm39)	Y51C	probably damaging	Het
S100a16	C	T	3: 90,449,879 (GRCm39)	Q121*	probably null	Het
Slc5a12	T	C	2: 110,447,089 (GRCm39)	V199A	probably damaging	Het
Slc6a7	A	T	18: 61,134,734 (GRCm39)	M447K	probably benign	Het
Tarbp1	A	G	8: 127,175,144 (GRCm39)	V764A	possibly damaging	Het
Vmn1r197	T	C	13: 22,512,678 (GRCm39)	Y200H	possibly damaging	Het
Vmn2r102	G	A	17: 19,914,402 (GRCm39)	A656T	possibly damaging	Het
Vmn2r49	G	T	7: 9,718,713 (GRCm39)	D450E	probably benign	Het
Wdr7	T	A	18: 63,911,048 (GRCm39)	N813K	probably damaging	Het
Yeats2	T	C	16: 19,998,308 (GRCm39)	S288P	probably benign	Het
Zfta	T	C	19: 7,400,305 (GRCm39)	V257A	probably benign	Het

Other mutations in Zswim6

Allele	Source	Chr	Coord	Type	Predicted Effect
IGL01670:Zswim6	APN	13	107,865,101 (GRCm39)	splice site	noncoding transcript
IGL02367:Zswim6	APN	13	107,880,637 (GRCm39)	exon	noncoding transcript
IGL02622:Zswim6	APN	13	107,884,786 (GRCm39)	exon	noncoding transcript
IGL03000:Zswim6	APN	13	107,863,650 (GRCm39)	exon	noncoding transcript
IGL03000:Zswim6	APN	13	107,863,649 (GRCm39)	exon	noncoding transcript
R0069:Zswim6	UTSW	13	107,875,098 (GRCm39)	exon	noncoding transcript
R0069:Zswim6	UTSW	13	107,875,098 (GRCm39)	exon	noncoding transcript
R0834:Zswim6	UTSW	13	107,862,989 (GRCm39)	exon	noncoding transcript
R1080:Zswim6	UTSW	13	107,924,186 (GRCm39)	critical splice donor site	noncoding transcript
R1542:Zswim6	UTSW	13	107,863,769 (GRCm39)	exon	noncoding transcript
R2081:Zswim6	UTSW	13	107,909,930 (GRCm39)	exon	noncoding transcript
R2133:Zswim6	UTSW	13	107,880,522 (GRCm39)	exon	noncoding transcript
R3692:Zswim6	UTSW	13	107,863,076 (GRCm39)	exon	noncoding transcript
R4323:Zswim6	UTSW	13	108,025,938 (GRCm39)	exon	noncoding transcript
R4345:Zswim6	UTSW	13	107,863,466 (GRCm39)	exon	noncoding transcript
R4369:Zswim6	UTSW	13	107,863,229 (GRCm39)	exon	noncoding transcript
R5049:Zswim6	UTSW	13	107,863,110 (GRCm39)	exon	noncoding transcript
R5111:Zswim6	UTSW	13	107,865,170 (GRCm39)	exon	noncoding transcript
R5174:Zswim6	UTSW	13	107,863,216 (GRCm39)	exon	noncoding transcript
R5531:Zswim6	UTSW	13	107,906,128 (GRCm39)	exon	noncoding transcript
R5933:Zswim6	UTSW	13	107,880,642 (GRCm39)	exon	noncoding transcript
R5934:Zswim6	UTSW	13	107,880,642 (GRCm39)	exon	noncoding transcript
R6063:Zswim6	UTSW	13	107,865,112 (GRCm39)	exon	noncoding transcript
X0022:Zswim6	UTSW	13	107,866,859 (GRCm39)	exon	noncoding transcript

Predicted Primers

PCR Primer
(F):5'- CATTACTGAGGTCCCACTTCTAAC -3'
(R):5'- GTTTGCAACGTGGCCATCAG -3'

Sequencing Primer
(F):5'- GAGGTCCCACTTCTAACACTTC -3'
(R):5'- AACGTGGCCATCAGCTTTG -3'

Posted On

2017-10-10