Incidental Mutation 'R6169:Htt'
ID490300
Institutional Source Beutler Lab
Gene Symbol Htt
Ensembl Gene ENSMUSG00000029104
Gene Namehuntingtin
SynonymsHD, Hdh, htt, huntingtin, IT15
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6169 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location34761740-34912534 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34907473 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 3010 (V3010A)
Ref Sequence ENSEMBL: ENSMUSP00000078945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080036]
Predicted Effect probably damaging
Transcript: ENSMUST00000080036
AA Change: V3010A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000078945
Gene: ENSMUSG00000029104
AA Change: V3010A

DomainStartEndE-ValueType
low complexity region 18 65 N/A INTRINSIC
SCOP:d1qgra_ 92 370 1e-12 SMART
low complexity region 371 388 N/A INTRINSIC
low complexity region 432 453 N/A INTRINSIC
low complexity region 1150 1161 N/A INTRINSIC
low complexity region 1423 1441 N/A INTRINSIC
Pfam:DUF3652 1494 1534 9.3e-20 PFAM
low complexity region 1812 1822 N/A INTRINSIC
Blast:GAF 1866 2040 1e-104 BLAST
low complexity region 2461 2472 N/A INTRINSIC
low complexity region 2611 2621 N/A INTRINSIC
low complexity region 2622 2635 N/A INTRINSIC
low complexity region 2857 2872 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124272
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201636
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 94% (67/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Huntingtin is a disease gene linked to Huntington's disease, a neurodegenerative disorder characterized by loss of striatal neurons. This is thought to be caused by an expanded, unstable trinucleotide repeat in the huntingtin gene, which translates as a polyglutamine repeat in the protein product. A fairly broad range of trinucleotide repeats (9-35) has been identified in normal controls, and repeat numbers in excess of 40 have been described as pathological. The huntingtin locus is large, spanning 180 kb and consisting of 67 exons. The huntingtin gene is widely expressed and is required for normal development. It is expressed as 2 alternatively polyadenylated forms displaying different relative abundance in various fetal and adult tissues. The larger transcript is approximately 13.7 kb and is expressed predominantly in adult and fetal brain whereas the smaller transcript of approximately 10.3 kb is more widely expressed. The genetic defect leading to Huntington's disease may not necessarily eliminate transcription, but may confer a new property on the mRNA or alter the function of the protein. One candidate is the huntingtin-associated protein-1, highly expressed in brain, which has increased affinity for huntingtin protein with expanded polyglutamine repeats. This gene contains an upstream open reading frame in the 5' UTR that inhibits expression of the huntingtin gene product through translational repression. [provided by RefSeq, Jul 2016]
PHENOTYPE: Null mutants gastrulate abnormally and die in utero. Conditional mutants are small with progressive neurodegeneration. Knock-ins of 20-150 CAG repeat units variably mimic Huntington's with late-onset motor defects, reactive gliosis and neuronal inclusions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik C A 11: 3,938,005 C127F unknown Het
9930111J21Rik2 A T 11: 49,019,261 probably null Het
Adamts16 A T 13: 70,770,274 L676* probably null Het
Adgrv1 A T 13: 81,419,259 V5265E probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Akap6 T A 12: 53,142,358 M2185K probably benign Het
Ankfy1 G A 11: 72,754,459 C788Y probably benign Het
Ankrd50 A G 3: 38,455,839 V793A probably damaging Het
Arid2 T A 15: 96,368,677 N535K probably benign Het
Atrnl1 A G 19: 57,642,463 T221A probably benign Het
Bbof1 C T 12: 84,426,814 T306I probably benign Het
BC005561 T A 5: 104,518,396 N261K probably benign Het
Cabs1 C T 5: 87,979,754 T88I possibly damaging Het
Ccdc60 C A 5: 116,137,072 A351S probably benign Het
Cetn3 A C 13: 81,791,978 R44S probably damaging Het
Cluap1 A G 16: 3,928,561 K262R possibly damaging Het
Cnrip1 G A 11: 17,054,731 V94I probably null Het
Cog6 A T 3: 53,007,301 S245T probably benign Het
Disp2 T A 2: 118,791,550 V921D probably damaging Het
Ep400 T C 5: 110,741,997 K504E possibly damaging Het
Fam189a1 G A 7: 64,759,399 P416S probably benign Het
Fbn1 T A 2: 125,335,489 probably null Het
Fyb2 T C 4: 105,000,516 V630A probably benign Het
Gm13088 T C 4: 143,654,115 Y446C probably benign Het
Gm43218 T A 6: 70,240,622 Y50F probably benign Het
Gm5431 T C 11: 48,888,575 T507A probably benign Het
Gucy2e G T 11: 69,236,104 A181E probably benign Het
Hrnr C G 3: 93,325,755 S1100* probably null Het
Ighv1-11 T C 12: 114,612,298 Y99C probably damaging Het
Ighv1-12 T C 12: 114,615,957 K25E possibly damaging Het
Il6ra A G 3: 89,871,291 F417S probably benign Het
Itgb4 T C 11: 115,994,276 S994P probably damaging Het
Itgbl1 G A 14: 123,660,378 A24T probably benign Het
Itpr1 T C 6: 108,369,116 F127L probably damaging Het
Krt86 A G 15: 101,476,289 Y243C probably damaging Het
Lnx1 A T 5: 74,677,569 W11R probably damaging Het
Mast4 A G 13: 102,787,421 L302P probably damaging Het
Mettl3 A G 14: 52,298,757 V210A possibly damaging Het
Mllt1 T C 17: 56,899,822 T341A probably benign Het
Obscn T C 11: 59,000,499 E7069G unknown Het
Olfr387-ps1 A T 11: 73,665,334 T242S possibly damaging Het
Olfr547 T C 7: 102,535,272 I175T probably benign Het
Osgep A G 14: 50,919,752 V11A possibly damaging Het
Oxld1 G A 11: 120,456,849 A174V possibly damaging Het
Pibf1 A T 14: 99,113,007 E197V probably null Het
Pkn1 G A 8: 83,681,206 Q425* probably null Het
Prss35 T C 9: 86,755,438 I87T probably benign Het
Psmc3 T C 2: 91,057,839 F304S probably damaging Het
Psmd11 T A 11: 80,460,713 M254K probably damaging Het
Ralgapa2 T C 2: 146,450,465 Y218C probably damaging Het
Sec23b C T 2: 144,586,974 R701C probably damaging Het
Slc22a21 A G 11: 53,958,087 S280P probably damaging Het
Slc39a12 T C 2: 14,400,233 I212T possibly damaging Het
Slc7a12 T C 3: 14,497,328 V255A probably damaging Het
Smc3 T A 19: 53,634,086 N697K probably benign Het
Snai1 C A 2: 167,538,911 P108Q probably benign Het
Ssfa2 T G 2: 79,645,062 I455R probably damaging Het
Stim2 T G 5: 54,118,679 L732R probably damaging Het
Syde1 A G 10: 78,586,104 L597S probably damaging Het
Tcte1 T A 17: 45,535,070 M200K probably benign Het
Tenm2 T A 11: 36,139,690 T761S probably damaging Het
Tlr2 C A 3: 83,838,148 E209D probably benign Het
Tpp2 T C 1: 43,983,579 L33P probably damaging Het
Trmt1l C A 1: 151,428,953 probably benign Het
Unc45a A C 7: 80,328,763 S646A possibly damaging Het
Usp37 A T 1: 74,495,751 I12N probably damaging Het
Vmn2r81 T C 10: 79,268,548 V335A probably benign Het
Wwc2 A T 8: 47,858,843 S762T unknown Het
Yeats2 A G 16: 20,219,667 K129E probably damaging Het
Zscan4-ps2 T C 7: 11,517,631 V198A probably benign Het
Other mutations in Htt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Htt APN 5 34799408 missense probably benign 0.00
IGL00233:Htt APN 5 34896026 splice site probably null
IGL00559:Htt APN 5 34849104 splice site probably benign
IGL00765:Htt APN 5 34877425 splice site probably benign
IGL00950:Htt APN 5 34891441 missense probably benign
IGL00953:Htt APN 5 34818677 missense probably benign 0.04
IGL00957:Htt APN 5 34806724 missense probably benign
IGL01314:Htt APN 5 34878856 missense probably benign
IGL01412:Htt APN 5 34898572 missense probably damaging 0.98
IGL01510:Htt APN 5 34907512 missense probably damaging 1.00
IGL01617:Htt APN 5 34876755 missense possibly damaging 0.67
IGL01893:Htt APN 5 34876830 missense probably damaging 1.00
IGL01914:Htt APN 5 34829709 missense probably benign
IGL01994:Htt APN 5 34832604 missense possibly damaging 0.83
IGL02102:Htt APN 5 34891481 splice site probably benign
IGL02381:Htt APN 5 34829760 missense probably benign 0.03
IGL02529:Htt APN 5 34819043 splice site probably benign
IGL02678:Htt APN 5 34899902 missense probably damaging 1.00
IGL02707:Htt APN 5 34829881 critical splice donor site probably null
IGL02731:Htt APN 5 34803793 missense probably benign 0.41
IGL02931:Htt APN 5 34876753 missense probably damaging 1.00
IGL03167:Htt APN 5 34818986 missense probably damaging 0.98
IGL03343:Htt APN 5 34826041 missense probably benign
IGL03344:Htt APN 5 34907466 missense probably benign 0.02
IGL03344:Htt APN 5 34879828 missense probably benign 0.39
IGL03366:Htt APN 5 34907580 missense probably damaging 1.00
IGL03410:Htt APN 5 34799445 missense probably damaging 0.99
Chalk UTSW 5 34907086 missense possibly damaging 0.86
IGL02796:Htt UTSW 5 34877482 missense probably benign 0.43
PIT4377001:Htt UTSW 5 34875965 missense probably benign 0.10
R0013:Htt UTSW 5 34820104 missense probably benign 0.25
R0049:Htt UTSW 5 34908662 missense probably damaging 0.97
R0049:Htt UTSW 5 34908662 missense probably damaging 0.97
R0056:Htt UTSW 5 34826078 splice site probably benign
R0207:Htt UTSW 5 34896908 missense probably benign 0.11
R0329:Htt UTSW 5 34817134 splice site probably benign
R0494:Htt UTSW 5 34821844 missense possibly damaging 0.73
R0548:Htt UTSW 5 34870746 missense probably damaging 1.00
R0601:Htt UTSW 5 34846003 missense probably benign 0.08
R0799:Htt UTSW 5 34817753 missense probably benign 0.00
R0947:Htt UTSW 5 34898924 missense probably damaging 1.00
R1053:Htt UTSW 5 34851217 critical splice acceptor site probably null
R1147:Htt UTSW 5 34851252 missense probably damaging 0.98
R1147:Htt UTSW 5 34851252 missense probably damaging 0.98
R1478:Htt UTSW 5 34803827 missense probably damaging 0.99
R1573:Htt UTSW 5 34864374 splice site probably benign
R1677:Htt UTSW 5 34828574 missense probably damaging 1.00
R1792:Htt UTSW 5 34907199 missense probably damaging 1.00
R1816:Htt UTSW 5 34803740 missense probably benign 0.01
R1833:Htt UTSW 5 34905748 splice site probably benign
R1837:Htt UTSW 5 34819023 missense probably benign 0.00
R1846:Htt UTSW 5 34848944 missense probably damaging 0.98
R1875:Htt UTSW 5 34794112 missense probably benign 0.05
R1899:Htt UTSW 5 34907085 missense probably benign 0.01
R2013:Htt UTSW 5 34852871 missense probably damaging 0.99
R2062:Htt UTSW 5 34825982 missense probably benign 0.00
R2064:Htt UTSW 5 34825982 missense probably benign 0.00
R2067:Htt UTSW 5 34825982 missense probably benign 0.00
R2068:Htt UTSW 5 34825982 missense probably benign 0.00
R2131:Htt UTSW 5 34877109 missense possibly damaging 0.50
R2162:Htt UTSW 5 34821718 missense probably benign 0.44
R2169:Htt UTSW 5 34877475 missense probably benign 0.08
R2345:Htt UTSW 5 34826004 missense possibly damaging 0.80
R2433:Htt UTSW 5 34907541 missense possibly damaging 0.65
R3027:Htt UTSW 5 34820095 missense possibly damaging 0.85
R3123:Htt UTSW 5 34804531 missense probably benign
R3125:Htt UTSW 5 34804531 missense probably benign
R3717:Htt UTSW 5 34811522 splice site probably benign
R3758:Htt UTSW 5 34895970 missense probably damaging 0.97
R3805:Htt UTSW 5 34877204 splice site probably null
R3833:Htt UTSW 5 34821718 missense probably benign 0.44
R4066:Htt UTSW 5 34878847 missense probably benign
R4272:Htt UTSW 5 34849069 missense possibly damaging 0.96
R4625:Htt UTSW 5 34829785 missense probably damaging 0.99
R4634:Htt UTSW 5 34875948 missense probably benign 0.06
R4655:Htt UTSW 5 34906132 missense probably benign 0.06
R4679:Htt UTSW 5 34820080 missense probably benign
R4684:Htt UTSW 5 34852765 missense probably damaging 1.00
R4832:Htt UTSW 5 34824840 missense probably benign 0.01
R4833:Htt UTSW 5 34852225 missense probably damaging 0.98
R4973:Htt UTSW 5 34813023 missense probably damaging 0.99
R5095:Htt UTSW 5 34824395 missense possibly damaging 0.89
R5132:Htt UTSW 5 34905679 missense possibly damaging 0.89
R5351:Htt UTSW 5 34803833 missense probably damaging 0.99
R5361:Htt UTSW 5 34907584 missense possibly damaging 0.47
R5399:Htt UTSW 5 34877151 missense probably damaging 0.98
R5462:Htt UTSW 5 34885507 nonsense probably null
R5552:Htt UTSW 5 34821774 missense probably benign
R5566:Htt UTSW 5 34849075 missense probably damaging 1.00
R5595:Htt UTSW 5 34905397 missense probably damaging 0.96
R5617:Htt UTSW 5 34870806 missense possibly damaging 0.77
R5835:Htt UTSW 5 34813190 missense probably benign 0.16
R5891:Htt UTSW 5 34870823 missense possibly damaging 0.62
R6158:Htt UTSW 5 34907086 missense possibly damaging 0.86
R6159:Htt UTSW 5 34804676 missense probably benign 0.08
R6242:Htt UTSW 5 34846012 missense probably damaging 1.00
R6274:Htt UTSW 5 34852087 missense possibly damaging 0.81
R6280:Htt UTSW 5 34870759 missense probably benign 0.00
R6294:Htt UTSW 5 34821826 missense probably benign
R6331:Htt UTSW 5 34895887 missense possibly damaging 0.89
R6448:Htt UTSW 5 34875992 missense probably benign 0.05
R6474:Htt UTSW 5 34824895 missense probably benign 0.06
R6592:Htt UTSW 5 34877044 missense possibly damaging 0.92
R6818:Htt UTSW 5 34782767 missense probably damaging 0.99
R6830:Htt UTSW 5 34834326 missense possibly damaging 0.82
R6920:Htt UTSW 5 34877100 missense probably null 1.00
R6962:Htt UTSW 5 34899771 critical splice acceptor site probably null
R7057:Htt UTSW 5 34821723 missense probably null 0.05
R7144:Htt UTSW 5 34846006 missense probably damaging 1.00
R7166:Htt UTSW 5 34852894 missense probably benign 0.42
R7329:Htt UTSW 5 34829755 missense probably benign 0.03
R7378:Htt UTSW 5 34803799 missense probably benign 0.04
R7418:Htt UTSW 5 34790353 missense possibly damaging 0.55
R7495:Htt UTSW 5 34811477 missense probably benign 0.00
R7554:Htt UTSW 5 34864740 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ACAAGGTGAGGGTGTACTTGC -3'
(R):5'- CTGAACTGGATGCTAAGTGAAC -3'

Sequencing Primer
(F):5'- CCTTGTGGGGTAAGGACAG -3'
(R):5'- CTAAGTGAACAAGGAACCTGGCC -3'
Posted On2017-10-10